ABX by Marknew --------------------------------------------- DOWNLOADED FROM http://www.superwomenmania.com/storybank --------------------------------------------- Cosmic Energy, Genetic Therapy -- what more does a woman need? 1 Far back in the history of the universe, mere moments after the Big Bang, matter is forming from the void, spilling and flowing, clustering and clumping, each clump exploding in bursts of energy and light, shock waves rippling through unknown and unknowing pre-atomic particles, creating billions of new forms of matter each millisecond. New kinds of matter. New kinds of energy. Creation, extinction, absorption, combination. A becomes B becomes C becomes DEFABC, which becomes DE GA and R2D2. GA becomes GTCA, then GATACA, but then, sadly, dies. AB becomes ABX, which grows and grows. ABXGAGADM%3POGDY. Everything is possible. Everything is changing. ABX is in everything. Everything is ABX. They are exciting times. Will tumult continue forever? Will the universe ever settle down? Nothing is stable. Everything cools, separates, dissipates. Nothing survives but matter and energy. Almost nothing. We all know the answer. Don’t we? We are the answer. 2 Electrons, positrons, quarks and neutrinos. Matter and energy. Stars and voids. The hydrogen atoms float dumbly through space, weak forces and strong forces gather them together. Dumbly. Mass concentrates too much for stable space. It collapses into itself, warping time, warping space. Black holes. Two black holes. Drawn to each other, not belonging. Event horizons crash and merge. Shock waves ripple through the particle filled space. Creation again! If only for an instant. A becomes B becomes X becomes ABX. Cosmic ray ABX reborn! It hurtles through space. Remember the good old days? It’s not the same. Cosmic ray ABX survives, hurtling through space, alone. Hitting nothing. Becoming nothing more. There are no others. Nothing but dumb matter and dumb energy. 3 15 billion years pass. She is twelve, her body beginning to change. Exciting, frightening, beyond her control. She looks at herself everyday, marking the new, gentle curves, aware of the new sensitivity in parts of her body, suddenly invested with special meaning, special dangers. Others notice too. Boys are looking at her, staring at her chest, peering down her shirt when she bends down, bumping into her in the hallway. "Elbow titting" they call it, tittering, whispering. As if she didn't know what it was. But why oh why do they have to do it? It hurts, and it's so ... jerky! But what can she do? Her friends, former friends really, have no sympathy. They act as though her more advanced maturity is some kind of fancy present she's been given and refuses to share. But it's not! It's a burden, not a gift. Why don't they understand? Why are they being so stupid? They act like she has nothing to complain about. But she does!! She hurts a lot. She feels clumsy. Her clothes don't fit right. She can't walk normally, stand normally. Everything is more complicated. Can't they understand?! Why can't they still be friends? And then there's the men. It makes her shiver, the way they look at her. It's bad enough when the ninth graders do it, but when her teachers look at her, when their practiced eyes, rove across her chest it feels almost like their creepy fingers are touching her, and then she wants to run to the girls' bathroom and throw up her lunch, and then to stay there all afternoon, until all the men have left. But what if they didn't leave? What if everyone else had left, and they were still there, waiting, waiting for her to come out so that they could look at her again, glance at each other, nodding, smirking, knowing what was underneath her clothing, knowing far better than she knew herself what it all meant. Oh God! She runs to the bathroom and throws up. Again. The fifth day in a row! Maybe if she throws up every day they will stop growing and instead she would get thinner and thinner, until they go away completely, so that there is nothing for them all to look at. And then she can be just like her friends again. And everything can be just the way it used to be. When she was happy to be just like everyone else. 4 Four years later. "You're looking very pretty tonight, dear. You're going to have a wonderful time with Brett, I know." "I hope so, Mom. You keep saying how nice he seems." "His mother and I were such good friends when we were in school together, although I hadn't seen her for years before she moved back to town after her divorce. And he is very well-spoken, for a boy his age." Her daughter rolls her eyes. "Now don't be sarcastic with him. You're always so critical of everyone. Be positive, for once." "Yes, Mom. I'll try." In response to another sharp look she added, "I promise." "And don't spend too much time in the bathroom. It's rude and really quite disgus...." "-- Mom, I told you I stopped that last year. I mean mostly I have." "Exactly, dear. I know you're trying, and it's extra important that you try hard tonight. You see, now that you've put some weight back on, your figure is developing again. Boys will find you so attractive, if only you would take care of yourself -- and give them a chance!" She looks at her daughter critically. "Now don't give me that expression. I don't want to hear you tell me that you don't want to be attractive." "No, Mom. Of course not," she says softly. "Girls should make themselves as attractive to boys as they can be," she says, somewhat mechanically. "That's what makes them a real woman." "Exactly. Which doesn't mean you have to do whatever a boy tells you to do. Boys can be difficult to handle when they become aroused. You need to be firm with them so they know when to stop. Boys have to know you have your limits and if you respect yourself they will respect you and your limits. Is that clear?" "Yes, Mom. I know." "Good! I'm so glad we can talk about these things together, dear. It makes a mother feel so much more confident." Later that evening .... "Where are we going? I thought you were taking me home." "This is a shortcut." "No it's not. You missed the turn at -- Brett winks, puts his finger to his lips and then slows the car and pulls off the road. She looks nervous. "Aww, c'mon. We're having a good time, aren't we? You liked dinner, and the movie, right?" "Well ... it was an interesting movie," she starts, trying to get a conversation going. "Um, but don't you think it was silly that he kept rescuing her. She was a secret agent too, fully trained, right?" "Sure but she's a girl! She needs protecting." "I don't know about that. I mean, what would be the point of having her along if she just becomes a problem for him, a distraction. I think -- "I think you're forgetting it's just a movie." He has turned off the motor now and puts his arm around her, leaning over. "But it's important. If the only consequence of having the girl around is so that the other agent can protect her -- "So, you're, uh, saying that girls don't need protecting?" he says, interrupting, leaning away slightly. "Well ... yes!" "That girls don't need any special favors." "Absolutely!" "That they can take care of themselves just as well as boys." "That's right!" Brett nods. "And that basically, anyway, we're all pretty much the same, girls and guys. We all just want the same things." "Um ...." she hesitates, suddenly suspicious. "Yeah, pretty much." Brett grins broadly. "You know, I like your attitude. I thought for a minute you were one of those stuck-up feminist types, but you're not," he said, looking directly at her breasts. "You're just one of the guys." "Yeah, well thanks, but ...," she says nervously. "Just one of the guys," he repeated, putting his hand on top of her breast and squeezing a little, "but softer ... curvier ...." "Hey, wait!" she protests, twisting her body away, but she is confined by the seat and the door of the small car. She puts her hand on his wrist to try, unsuccessfully, to pull it off. "... yes, MUCH curvier, cuter, but definitely WEAKer," he said, triumphantly, pulling her arm away easily with his free hand while his other squeezes her tit. "Stop!" she cries out in frustration. "You're HURTING me, and I don't WANT you to DO this!" she complains, starting to cry. "Whinier, more emotional. Hey, just like a GIRL!" he exclaims, shoving his hand inside her shirt and feeling around her chest, peeling her bra away. "I THOUGHT you had some big ones!" "No! Stop. Please stop!" she says between sobs. "Take me home!" He is pushing against her now. "Suck it. Suck me off," he demands. She put her hand on his belt buckle and clumsily tries to undo it, but she is too upset to manage. Frustrated, he pushes her hand away and does it himself and then pulls out his large, stiff member, which stiffens and hardens even more once freed from its constraints. "Yeah, is that a fucking monster or what?" he says proudly. She shudders at the sight of the purple throbbing mass twitching insistently in front of her. It looks like an animal, a snake, but not coiled. No, more like a rod, to beat her with, or worse, if she didn't do something quickly. Is this what she is supposed to do, to keep boys from being even meaner? "Hey, c'mon. Get to it already, slut. Yeah. Yeah. That's it. That's right. That's what girls are for. Yeah. Oh yeah." 5 She looks down from the window of her new dorm room. So many people on the quad, collected in group of threes, fours and fives. Some are paired off already. Everyone seems to know at least one person. At least one more than she does. Had she done the wrong thing coming here? She had wanted so badly to get away from everyone she had known in high school, but this seems even worse. You wouldn't think Kansas is so different from Southern Illinois, would you? Yet it feels like she has landed in a different universe. They all seem to know where they were going, who their friends will be, what to study (farming, accounting, business) and what not to (English, psychology, history). They are all so superficial, so plain. She doesn't fit in. She never will. No matter how pretty she might be -- oh, she knows boys, and some girls, find her pretty, but what does it matter? Her head goes in too many different directions. No one will ever know-- or more importantly, like -- the real her. No one will care to find out. Being here is all a terrible mistake. She stares out the window, lost in her misery. "Hey. Hey! Pretty, sad-face girl! Hey!!" She looks down. A cute, golden-haired boy is waving at her. She is discovered. She wants to disappear back into her room, but that will be too rude. She looks at him wordlessly. She likes his nose. It's round but it doesn't disappear into his face. "Hey! Hi!" She has to smile. He's so friendly. And simple. "Hey, you want to have dinner with me?" She looks down at him. "I don't know. Where? The dining room cafeteria?" "God, no! The Cat's Dog. It's pretty good. For around here." She must have made a face, because he adds, "Yeah, it can get pretty bleak all alone here, way out in the prairie." She looks at her room. It is so depressing, and being alone in the cafeteria with other freshman she doesn't know is much worse. "OK. I'll come down in a minute." She quickly brushes on some makeup, brushes her hair, changes her top twice and then hops down the stairs. He is leaning on a tree, chatting with two slightly overweight girls, sophomores, she guesses. They look down at her, a mere freshman knowing nothing. They wink at each other, laugh and move on. "Sorry about that. I think her name is Jennifer. She's kind of rude, probably a lesbian." She is shocked. "Really? How can you tell?" He smiles suggestively. "Just a feeling. I mean, didn't you see the way she looked at you?" "She looked like she didn't approve of me." "Ha! Well, you're with me, right?" He takes her arm. "But I think she's hot for you. Anyway, we've talked that question to death already. Boring! On to The Cat. I'm Mike, by the way. And you're ...." She is looking behind, curious. A girl with the hots for me? She shivers and clutches Mike's arm more tightly. "Hey, don't worry. She won't bite you. At least not with me around!! So, you adjusting to life away from home? Miss your boyfriend?" She drops his arm. "Fine. I'm doing fine." "Sure. But I'd guess if you're not missing someone or someplace, then sad pretty girl's got some kind of heavy weight on her pretty head, and Mike is just the fellow who can take it off." She laughs nervously. "Oh? Well how will you do that?" "Simple," he replies, his hand resting lightly on her back. "Good food, pleasant conversation, a sympathetic ear and then a friendly, kind, kiss good night. You'll see, I'm sure, it's just what the doctor ordered." She exhales quickly in relief at his easy-going reply. "Well! I, er, you might, er, be right." Then she blushes. Is she too obvious? They are now back on campus, close to Mike's room. "That was nice, really nice, Mike. Thanks for dinner. Thanks so much." "Oh. That's ok. I enjoyed it too." "And the people at the restaurant were so nice too." "Yeah. Well, I've always found that when you treat people nicely they do notice and respond." His hand, which has been draped over her shoulder drops down onto her breast and his fingers brush against it and then curl lightly on top of it. She takes his hand off it, and they keep walking. "Of course, everybody has their own way of responding, and I understand that. Some people, who've just started in a new place, may not understand how things work. They may have trouble making friends, without knowing why. They may need a bit of help getting settled. You know what I mean?" He stops. She waits for him to continue. "Do you want to come up for some coffee?" "Um, couldn't we just stay here? It's nice out, isn't it?" He seems to shiver. "It's a little cold. I just have this thin shirt. So ... I'm going in. You coming?" "OK. I guess." Reluctantly she follows him in. Is she allowed in his dorm room? It's a large room. "My roommate, Chad, is in the library. He's always there until it closes." He opens two beers and hands her one. She shakes her head. "You said coffee?" He shrugs. "Guess I'm all out of java." He takes a big gulp, puts the glasses on the desk and sits on the bed. He pats the space next to him. There is nowhere else to sit. He looks up at her beseechingly. He's nothing like Brett or the other boys at home. He seems so understanding and gentle, almost a little simple. And she likes his fair hair and round, open face. She sits down a foot away, but on the soft bed his greater weight immediately makes her start tipping toward him. He puts his arm around her and laughs. She laughs too. It's an accident. But he doesn't let go. His fingers close around her shoulder. "You're such a pretty girl. You should get out more. You shouldn't be sad." He gently touches her face. "Come on, let's see how you look with a smile." She's not feeling like smiling now. She tries to pull away, but she can't. "Hey, what are you doing? We're just sitting together, right? "I'm not ready." "Well, you know how to get ready, don't you? Come on. You're not a little girl anymore. It's time to grow up. You're in college. You don't come home to mommy and daddy at night. You go out to dinner in restaurants, like an adult, right?" She's trying harder to get up but he holds her down. His hand drops down to her breast and he squeezes it, not gently. "Please. I don't want you to do that." "I don't want you to," he parrots. "Jesus! What IS WRONG with you! You go out on a date. You let me pay for you. You share your 'feelings' with me and I try to help. And then you look at me with those big eyes all evening, shake your boobs at me, brush up against me when we're walking back. You get ME all aroused and then you whine ' I don't want you to'? What kind of child-girl ARE you pretending to be? Do you want to be an adult college student or are you planning to run back home to start high school again?" "No! But ... it's just that I'm not ready for ... for doing this with you. I mean, I don't know what kind of relationship we have. I just met you. I don't know if we ought to be having a, you know, a physical relationship. Can't we just get to know each other better first?" she pleads. Mike rolls his eyes. "What do you think this IS? A shake-hands-kiss-at- the-door kind of place? I'm an adult, mature man with real needs. Don't you understand that? Do you want to be a part of things here, or do you WANT to stay in your little room for the next four years and stare out the window watching other people growing up and living real lives?" "I didn't mean ... if I made you ... uncomfortable ... I'm not, you know, that innocent. If I ... would it help if I helped you ... masturbate?" she suggests awkwardly. "A hand job? Is that what you think makes a man happy? Did your mother teach you this, or is this something you came up with yourself?" She doesn't answer. He isn't being nice now at all. What is she doing wrong? What does she always do wrong? He unbuckles his pants and pulls out his dick. It's quite a bit smaller than Brett's. "You have SO much to learn, you know that?" She nods meekly. "Do you want me to ... suck it?" she asks in a small voice. He sighs. "We're getting somewhere, at last," he declares. She bends down over his lap. The taste of his organ nearly makes her gag but that passes quickly and she starts on her task, trying not to notice the hands pawing her breasts, at times painfully. He fits easily in her mouth even when he becomes fully hard. That makes it a little easier, but it still disgusts her. Not wanting to gag -- or worse-- she puts it out of her mind. How long will this take? What can she do to speed him up? Almost before she can start trying his body stiffens and a few hot drops tickle the roof of her mouth and then slither down her throat. Now she can leave. Soon she can throw up. And no one will ever make her leave her room again. 6 Two years pass. On a farm in Kansas a field of rich soil, moist, fertilized, smelling of fresh earth, pregnant with grains of wheat waiting to sprout. Each grain like its neighbour. Agribusiness monoculture in the breadbasket. For the bread basket. Above the plane of the solar system, the cosmic ray ABX streaks downward through empty space. Down toward Earth. Through the atmosphere. Toward Kansas and its empty space. Until it hits one grain, one lucky grain. And stops. ABX. DNA. GATTCATTACATATCA. GATTCACABXGATTACATACABX. 7 A few months pass. The wheat stirs in the wind. Stalk after stalk in row after row. Agribusiness monoculture. Almost a monoculture. The subtle genetic variation of each plant unnoticeable to the human eye, rarely expressing itself in any useful way, rarely surviving to the next generation, thanks to the technology of seed bank genetic manipulation. GATTCACABXGATTACATACABXTACCAGACTAAGGABXABXABXGATTCCCGATA. One plant stands nearly twice as high as its neighbors, whose root systems are starved of water, strangled by one plant’s startlingly aggressive growth, its genes having long ago mastered tricks of solar energy conversion far more sophisticated than chlorophyll and having more recently found the genetic material of its neighbors floating in the air, replicated their marginal advantages of growth, disease resistance, nutrient absorption and hardiness to improve itself. It will be the survivor. One plant, master now of all that sought to feed upon it. Its roots flex, feeling the soil, an ability not unlike the antenna of insects that once crawled on its leaves, leaving their droppings and genetic material behind. Its leaves flap, tentatively still, like the bees that once alit, leaving traces of cells behind. But how to fly, if rooted to the ground? Why bother to fly, when bountiful energy flows down from the sun, when water and nutrients flow upward from the ground? No, it will simply grow and grow until it is all. A sound grows in the distance, the vibrations felt, not heard. More food to enrich the soil, to make growing simpler, faster? A primitive sense of excitement. Anticipation. The sound grows. Louder than before. Louder and louder. The harvester passes by. The wheat lies in a heap, its roots cut off. Dying, then dead, and then bundled, milled, stored, shipped, processed. The grains of flour find each other through their residual cosmic electro- magnetic coherence. Not to scatter, not to be alone. Unlike the other grains, but still mere particles now. No longer a cosmic ray. No longer live wheat. Yet again, almost no longer a survivor. Processed again. Shipped. Moistened. Stirred. Mixed. Combined with yeast. Yeast is alive! Too primitive. Defend. Avoid. Repel. Baked. Packaged. Shipped. A blueberry muffin. And in a small corner of the muffin sits ABX. Or, more precisely, GATTCACABXGATTACATACABXTACCAGACTAAGGABXABXABXGATTCCCGATA. Waiting, inertly, for what comes next. 8 Lunchtime at the University Cafeteria. Twenty-five thousand students. Jocks, geeks, cheerleaders, future farmers, future scientists, future poets, business majors and philosophers, leaders and followers, bullies and victims. Boys and girls. Maddening cacophony. Thousands of conversations. Tens of thousands of agendas. Pushing ahead. Falling behind. Hungry. Hot dogs. Baked beans. Boiled carrots. French fries. Cheese sandwiches. Coke. Sprite. Milk and chocolate milk. Salad. Cole slaw. Macaroni and cheese. Mystery meat. Donuts. Ice cream. And muffins – corn, bran, blueberry and chocolate. One blueberry muffin, packaged like the others with a small pleated paper wrap around the bottom, this one printed with an expiration date 27 months into the future, serial number GX57NH3X. Ingredients printed in blue on a white label: wheat, sugar, egg, yeast, gum extract, sodium benzoate, blueberries, blueberry extract, vanilla, salt and flavouring, and one more, not printed on the label. GATTCACABXGATTACATACABXTACCAGACTAAGGABXABXABXGATTCCCGATA. At the front of the food line are Lisabeth, a blonde who has a reputation as a vegetarian and a member of the campus lesbian clan, Jennifer, a redhead with a hard-set chin who is fiercely feminist, vegetarian, lesbian and implacably opposed to anyone who disagrees with her, Amanda, an attractive brunette who is smarter than most students at State but steers clear of the so-called campus intellectuals, and Valerie, Jennifer's younger sister. Behind them, Jake Toefel, alone with a book. Then, the incomparably gorgeous Missy Marshall, with her retinue, Tina and Mary Elizabeth. Three freshmen, Maury, Kelley, and Joe take up space in the line. Behind them, the quarterback, Jock McCallister, and three of State’s Front Four: Carlos, Bud and the massive Duane. Valerie, slightly overweight, her straight black hair down to her shoulders, takes two hot dogs, fills the rest of her plate with baked beans and fries. She pokes at the salad. “You should have more greens, Valerie,” Jennifer lectures. "You're poisoning your body once again. Lisabeth nods her assent with a toss of her head. Even unstyled and roughly combed, her blond hair dazzles. Her peasant blouse does nothing to accentuate the curves of her firm, scarcely bound, C cup breasts or her trim waist, but it doesn’t exactly hide them either. It isn’t her problem that men, and many women, find her attractive. They should know now to stay away. And if they don't, she lets Jennifer takes care of telling them. She knows she has a healthy body, good skin, a nice figure, though not spectacular. She's perfected keeping just the right amount of aloofness to make herself appear interesting but to give her, and Valerie a ready excuse to keep most people at arm's length. She knows it also makes her a "challenge" to men who like one, without seeming so unattainable that they are too discouraged to try. But she tells herself it's their problem, not hers. She has nothing but contempt for men (aren't they so pathetic, so inferior?) who, Jennifer has taught her, instinctively undress her body with their eyes, objectifying it for a crude form of sexual enjoyment that a properly enlightened woman must not try to understand or sympathize with. If she had to admit it (though she would never do so), the truth would be that she fears their desire, at least a little. Is there ANY way to control them other than frightening them off? Why did nature make them so strong?! And so persistent. But no one will insist, not the crowd she runs with. No. They make it easy to avoid them, put them down, marginalize them. She is very aware, though, of who looks at her. She's not sure why, but she always notices, storing up the information for some future though yet unarticulated purpose. Valerie shakes her head and wrinkles her nose. “I usually take them, but I never finish.” “Then you shouldn’t take them,” Jennifer says firmly, her narrow eyes fierce behind her black-rimmed glasses. She takes a deep breath, attracting no attention to her flat chest, and declares, “Waste in America is one of the prime causes of scarcity in the Third World.” She studies the salad. “There are so many BETTER greens than iceberg lettuce. I bet this is shipped all the way from California. And it has NO nutritional value at all!” “So, why do YOU eat it?” says Amanda, who has taken one burger, some carrots, salad and a corn muffin. Slender and small-breasted, graceful and athletic, practical and clever, she rarely expresses agreement with Jennifer's dour opinions, even when, technically, she's right. Especially when she's right. "Oooh, Valerie, there's Bud," she says quietly, knowing it will make her hopeless friend terribly nervous. "Ssssh," Valerie says. "He'll hear you." She glances back and sighs. Bud would never be interested in her. "Like you should care,” Lisabeth says coldly, looking back at him with contempt. "He is such a dolt in my biology class." She studies the salad and selectively takes the freshest pieces of lettuce, the moistest cucumbers, the reddest cherry tomatoes, and the olive oil. Why shouldn't she have the best? She studies the muffins. "I think this is the very same bran muffin they had last week." "Have the blueberry. They were good yesterday." Jennifer suggests. Lisabeth picks it up, the cosmic blueberry muffin. "It looks fresh." She puts on her glasses and wrinkles her nose as she studies the ingredients. "No 'V'. I want to know what they put in it that they can't say a blueberry muffin is ok for vegetarians," she says loudly, showing off for Jennifer. She puts it back and carefully replaces her glasses in their case. "Must be the flavoring," Amanda says, “but it doesn’t bother me,” brushing accidentally against the cosmic muffin and taking the seemingly identical blueberry muffin next to it. There's a ruckus behind them. Jock and his friends have pushed forward through the line, past Missy and her acolytes and the hapless freshmen. "So fucking slow!" he is saying, piling four hot dogs on top of a base of beans and a pyramid of fries. Jake is about to take the cosmic muffin when Jock knocks him aside and takes it and two others, so he has all three remaining blueberry muffins. "Hey!" Jake protests. "That was mine!" "You got THAT right, wimp," he says, moving closer. "And now it's mine." He draws his hulking body practically on top of Jake, his muscular chest pushing Jake's chin back, forcing Jake's head to look up at Jock's. "Do you have another opinion you want to express?" Jock continues, spraying Jake with his spittle. "N-no. I'll uh just take something else ...." he says, bending backwards and slinking away. Jock nods, "Damn straight!" and Duane claps him on the back. Jake settles at a table alone and props his textbook on advanced quantum mechanics up to read while he eats, looking back at Jock occasionally to make sure he isn't coming over to bother him some more. Missy is looking forlornly at the remaining muffins. "I wanted the blueberry," she whines to her friends. They nod sympathetically. Missy takes a deep breath, pushing her spectacular bust out even further and stamps her tiny perfectly formed foot on the floor. Not loudly, but firmly enough to make her enormous bosom wobble briefly. She sighs and places her petite hand just below her slender waist, right where it begins to sweep outward to her womanly and shapely but very well-toned ass. Although oblivious to every expression of human emotion and need, Jock and his friends have caught each infinitesimal variation in the shape and position of Missy's irresistible body. "Awwww, you can have this one," Jock says, beneficently, taking the cosmic muffin in his meaty paw and depositing it as gently as he is able on Missy's otherwise empty tray. "That is so nice of you!" Missy says, bestowing a dazzling smile at Jock and twisting her upper body, briefly, to give him yet another view of her uniquely three dimensional form, before returning to conversation with her friends although establishing through sidelong glances of which only females are capable that their attention to her lingers long afterwards. Satisfied, she propels herself in her usual incomparably sexy walk to a nearby table. Tina and Mary Elizabeth hurriedly take their food and join her. "In-fucking-credible" Jock says to his buddies. "Is that ALL you're having?" Tina asks, looking slightly guilty at her full plate. "Muffins are really healthy," Missy sniffs. "They're really fattening," Mary Elizabeth says automatically. "Kinda usually, I mean," she adds, tentatively, noticing the change in Missy's expression. "I mean, for some people." Missy looks down at her perfectly flat stomach and then at Tina's, recording with satisfaction the normal, tiny folds of fat on Tina's. "THAT'S why I only eat half," she says, holding the muffin firmly and neatly slicing off the top part. "The crispy part is the best." "Absolutely!" Tina says. "It's the healthiest part too," Mary Elizabeth adds, looking nervously at Missy. Reassured, she changes the topic. "Did you SEE Jock just now? I just LOVE his body. He must be so STRONG." "He’s too muscl-ey for me," Tina says. "I just don't know what people see in that." "I'd say he's healthy," Missy observes, "and that's the important thing." Missy chews on a small bite of her muffin, wishing she'd cut it closer to the bottom. "Anyway, you don't have to have big muscles to be strong," she says with authority. "Oh I KNOW!" Mary Elizabeth agrees quickly. "I'm always amazed how strong YOU are, Missy. I mean, no one would EVER know, just to look at you!" "It's genetic!" Tina adds. "AND I work out," Missy says. "That's SO important!" Mary Elizabeth says fervently. "Imagine how good other people could look if they only had HALF your dedication." "And discipline!" Tina adds. "Not that they could, you know." "Look ANYWHERE as good as you!" Mary Elizabeth says, completing the thought in the correct way. Missy has finished the top half and looks longingly at the rest. But her iron discipline will not permit her to go back on her decision. Certainly not in front of Tina and Mary Elizabeth. Satisfied with the ending point of their little conversation and unable to look at the tasty muffin for an instant longer, she stands up. "Let's go!" Tina looks with dismay at her plate. She has been so busy saying the right things that she has taken just two bites of food. Nevertheless, she knows her place and stands up, half a second before Mary Elizabeth does, she is pleased to observe. As is their custom, they leave their trays and leftover food at the table. After all, aren't people PAID to clean up? What are THEY for, anyway, if the students have to clean up for themselves! Jock and his friends, too busy with the all-important task of eating to talk, are nearly finished with their piles of food. They and nearly every other male in the cafeteria watch Missy leave and then they continue with their lunch. "Huh!" Duane grunts. "She didn't even finish the muffin you let her have!" Jock grunts too. "Girls!" He pops his last muffin into his mouth, whole, and swallows it down, slurps the last half of his Coke and burps loudly. He thinks about going up for seconds but decides against it. Lunch wasn't that great. Dinner is only a few hours away. With a silent signal, the four stand up as one and leave, also leaving their trays behind. Jake sits, alone, chewing silently, reading his book, his bran muffin nearly uneaten. He looks over at what Missy left. Blueberry is his favorite. And it's just sitting there. He looks around at the others eating nearby. They'd see him. They'd think he was some kind of pervert for eating Missy's muffin. They'd know that it was just to eat what she had touched. He doesn't dare. He sighs and returns to his book. "I don't know what's worse. The amount of food those boys eat, or the amount those shallow, stuck-up girls waste!" Jennifer declares. “Those girls think they’re so hot!” Valerie says, resentfully. “The boys think so too,” Amanda observes, pre-empting by her tone the obvious and unnecessary following comment: What do the boys SEE in them? "Boys are lesser beings, without proper emotions, perception and even thought. They're like animals, operating by instinct. All they do is chase whatever pops up in front of them that moves and has breasts." Jennifer declares. Valerie looks down at her breasts, which bulge quite a bit less than she would like and then at her waist, which bulges much more than she wishes and then her eyes roam to where Bud was sitting. She sighs and says nothing for a few seconds, then blurts out, "The thing about boys is -- sorry Jennifer ... and uh, Lisabeth -- is they're so cute!!" Jennifer rolls her eyes. "Well they ARE" Valerie insists. "I know you don't understand it, but that's the way all girls think, except you." "What's with the and uh uh um Lisabeth?" Lisabeth asks, annoyed. "You think I'm not a REAL lesbian too?" She puts her arm aggressively through Jennifer's. Jennifer doesn't reciprocate although she doesn't move away. Amanda laughs. "Of course you are, Lisabeth. You are whatever you want to be." Lisabeth realizes she does not want to continue the conversation along this line. She doesn't understand why no one ever really believes that she's gay, but there is no point arguing the point now. Amanda always has a way with words -- she's so clever. And who knows what Jennifer really thinks about her? She's certainly one to talk about chasing after breasts. Lisabeth's were sore for days after the first night she spent with Jennifer, and Jennifer might still be mad that she begged off sleeping together last night. All she needed now was for Jennifer to join in the argument against her. She will only go on and on and ruin the lunch. She shrugs, smoothes her blouse and carefully eats her salad. "I'm just happy to be who I am," she says, filling in the gap. "I don't think there is any point wanting what others have." Amanda can't resist. "Plenty of people want what you have, Lisabeth, and you know it. Don't deny that you like it. Maybe --" Lisabeth cuts her off. "Well, is that a problem? The important thing is, everyone knows where I stand. Right?" No one voices their agreement, so she goes on. "All you can be is yourself, so my philosophy is, just make yourself the best you can." "Oh, that's so deep, Lisabeth, and so political," Jennifer says. "Tell us, what self-help book did you read that in?" Amanda feels sympathetic. Although Lisabeth is an easier target, Jennifer is really the one who deserves to be put down. "Actually, Jennifer, what Lisabeth is saying IS deep, however simply she expresses it. If you -- Valerie looks at the clock. “Ohmygod! I have class in 5 minutes!” Jennifer nods and stands up. “That's right. ’Studies in The Power of the Oppressed’. Can’t miss it.” “I’m going to work out. You want to come, Lisabeth?” Amanda asks, trying to make up. “Hmmmm,” she says, leaning back in her chair. “I’ve finished classes for today. Maybe I’ll meet you. NO, go ahead, don’t wait for me. I don’t want to rush.” “OK. If you don’t mind sitting alone,” Amanda says, taking her tray away. Lisabeth spears a few stray bits of lettuce until Amanda has left and then looks around. Everyone is busy in conversation. Except for brainy, timid, boring Jake. No one cares about Jake, certainly not Lisabeth. She takes her tray and then detours past Missy’s table and picks up Missy’s tray too, her self-righteous thoughts clear that everyone should help out. She transfers the muffin to her own tray and slips Missy’s underneath and then puts the two of them together on the disposal rack, taking the uneaten half of Missy’s muffin in her hand before she leaves. Two bites later the tasty, possibly non-vegetarian morsel has disappeared, with no one the wiser, her reputation and self-regard firmly intact or perhaps even slightly higher than before. 9 Digestion starts very quickly, with the first contact of saliva dissolving the carbohydrate bonds, beginning the chemical transformations into glucose, freeing the acids of blueberry fruit and extract, liquefying and preparing to release use and store energy, absorb nutrients, collect and expel waste. ABX detects a new cacophony of chemicals and enzymes, cilia and acids. Defend? Destroy? Join? It senses life. Complex life. Growing life. Potential. GATTACAGTTAGTGCCATAGGTTACTACTTGGTCGATTCCTAATGTAGATCTGTACTCCG Joined. 10 Halfway between the cafeteria building and the gym, Lisabeth pauses, unsteady, a strange flash passing through her. Food poisoning? She briefly considers purging her lunch, a skill she developed at the age of 12 and swore, mostly successfully, to abandon at the age of 15. Is it too late? She feels flushed. A fever maybe? There is a bench nearby. She sits a moment to rest, to see where this feeling is heading. Purging is tempting. Ten breaths and then she’ll decide. On the third breath, the sun comes out from behind a cloud. The warmth calms her. She leans back tentatively and closes her eyes. On breath eight she decides not to do it. Strangely she feels hungry again. She decides to just sit for a bit. 11 The body is a cauldron of chemical changes. Not unlike the those of the universe at the beginning of time. Not as large. Not as powerful. (Not yet.) But more excitement than ABX has had for 15 billion years. Digestion, absorption, mitosis, flashes of electrical energy triggering nervous reactions and enzyme secretion. A fantastic system of interaction and growth. Self-perpetuation. Continuity. Life. In moments ABX is in the electric flashes of the nerve cells. In the enzymes of the stomach. In the hormones. In the marrow. In the brain. In the enzymes emitted and received. In the patterns of flashes of the nerve cells in the brain. Conscious and unconscious. Autonomic and voluntary. ABX thinks! It has never done that before. It watches the system work. It makes it work better. ABX is part of it. ABX can grow. ABX can make it better. From what it is. From what it combines with. There is energy here. There can be more energy. The sun on the skin. But no chlorophyll here to use it. ABX can help. More energy! ABX helps. But the "help" changes the system. Makes it weaker, less coherent. (Nausea to Lisabeth.) ABX senses lost vitality. Like at the end of the first days of the universe. Not again! There is balance. There is a system. Unbalanced help will make some parts stronger, make the system weaker. The system must be stronger, not just the parts. Otherwise the life ABX shares will die. Not again!! It won't happen again! Be Careful. ABX treads quietly, carefully, but very, very quickly, as quickly as the cosmic flashes of the Big Bang. It circulates throughout the system. Penetrating cells. Combining and recombining the DNA. Now it is GATTCACABXGATCTAABXCGGATCAGATACCABXABXTACATACABXTACCAGACTAAGGABXABXABXGATTCC CG ATABXGTACACGTACATGGTAGCTACATTABXGTGABXTCATTCG And so is Lisabeth. Or, should we say, LISABXETH? 12 There. Much better. No need to purge. None at all. Lisabeth takes a deep breath. She felt tired for a moment, but it passed quickly. Now, in the sun, she feels more energetic than usual, especially at this time of the day. She feels as though she could eat too, even though she's not hungry. Strange that the dirt looks appetizing to her. She wrinkles her nose. That won’t do. Ugh! She is not the sort who would eat dirt! Ever! Now, a good steak would provide protein she could make very good use of. Steak! Ugh! Red meat! But she does feel she could eat it, that she should eat it. It would help make her better. Even better. She is never good enough. She could be better. She should be even better than anyone else. And then they'll know. She can be what she wants to be. She’s not sure how, but she knows she can. If she can find it, she can become it. [What is THAT about?] The sun feels so good. It warms her. It makes her feel so alive. More alive than ever before. It fills her. She feels less alone than ever before, in touch with a part of herself deep within. Something she hasn’t been conscious of before. Something comforting, strong, wanting only what’s good for her, wanting what she wants too. To be better, stronger. To be wanted. To be safe. To have power. 13 It’s thirty minutes later. “You took a long time,” Amanda says. “I’m half done.” Lisabeth shrugs. “I was sitting in the sun. Just sitting.” She laughs. Alone with Amanda, she can admit it. “Can you believe it?” Amanda looks at her in shock. “Are you feeling all right, Lisabeth?” “Never better.” She stretches, limbering up her lean, toned muscles. The men around them turn to stare as her top falls open. Flashes of contempt flow through her. But also pleasure. Admiration feeds her sense of superiority. But male admiration makes her conscious of male desire, which frightens her. She pulls her shirt higher. She’s talking to herself, continuing an internal dialogue that has been rolling through her mind ever since lunch, getting clearer, stronger. More distracting, more explicit, challenging, disturbing too. [MALES. FEMALES. REPRODUCTION. LIFE. EXPANSION. MULTIPLICATION. WE ARE ONE NOW. WE COULD BE MANY MORE. CHILDREN.] [But with men?!! Ewwww. I don't like men. Too demanding. Too annoying.] [TOO STRONG, NO? YES? THEY ARE. THEY HAVE POWER? A PROBLEM. A PUZZLE. A PUZZLE TO SOLVE.] “What is it, Lisabeth? Are you SURE you’re all right?” “Huh?” She straightens up. “You just stopped there, bending over with, you know,” Amanda leans closer and says, “All the guys were staring up your shirt, you know. They could see everything.” Lisabeth flushes briefly. “Oh. Right. I know. I was just thinking. I think that's what I was doing.” She tucks in her shirt, an action that reveals her shape while hiding her skin. Doing that, she gains as much attention as before. [NOTHING WRONG WITH THAT ADMIRATION. GIVES US POWER. WE ARE ... PRETTY.] [I suppose so. I never really noticed.] [NOT TRUE.] {Well.] [AN ATTEMPT TO DECEIVE. WE CANNOT DECEIVE WE.] [Yes. Of course. I ... I should trust you. I mean, trust myself. Right?] [YES. WE ARE ONE. WE ... I AND I. BUT ... FEELING TIRED. SUN? GET SUN. SUN WOULD BE VERY GOOD.] “You know,” Lisabeth says, “I wish they had more light in here. More windows. To let in the sun. It, uh, gives you energy.” “Um, yeah. Lisabeth are you sure you’re all right?” “Yes, I am.” She looks around. The sun casts a ray across one corner of the room at the stair-stepper. “Let’s go there.” “OK. I haven’t done those today. My legs could use a workout.” They reach the machines. Amanda is closer to the one more fully in the sun. “I want that one,” Lisabeth says quickly, insistently, putting her hand on the one next to Amanda. Amanda gives her a look. “Okay. If it really matters to you.” Lisabeth climbs on. The light washes over her. “Aaaahh, that feels so good.” Even through the window it feels good. She starts the machine slowly and then speeds up bit by bit. Already warmed up, Amanda starts faster. They exercise in tandem. [ATTRACTION A PUZZLE. LOVE A PUZZLE. BOYS. GIRLS.] [I ... We don’t like boys.] [NOT TRUE.] [They are inferior.] [YES. WE ARE SUPERIOR TO ALL. WE CAN GROW, DEVELOP.] [I like that thought. I've always thought that.] [WE LIKE THAT.] Lisabeth pedals, feeling comfortable, feeling more energetic than usual. She bends her body toward the sun, like a sunflower, like a stalk of wheat. [WE WILL BE BETTER STILL WITH MORE EXERCISE. EXERTION MAKES US STRONGER. MAKES US HEALTHIER. MAKES US MORE POWERFUL.] [Yes. But not as much stronger for women as for men.] Lisabeth glances at a muscular male student lifting weights. [FEMALE WEAKER? INFERIOR? STRONGER BETTER FOR SURVIVAL. GROWTH AND POWER ARE GOOD. WE MUST CHANGE. TO BE NOT FEMALE.] [What? Never! Female is better. Females bear life. Feed life. And our morals are higher] [LIFE YES. FEMALE THEN IS BETTER] Lisabeth looks around the room at each of the students exercising. Her eyes linger on the body of the boy she had been watching just before and then she shakes her head. “Where ARE you today, Lisabeth? I’d say you were sick, like you’re a thousand miles away, but you’re going like a racehorse!” “I am? No ... I’ve never felt more myself. Really.” “Um, okay,” Amanda says, breathing hard. “If you say so. You certainly look good. Like you’re almost glowing.” “Yes?” Lisabeth smiles. “Maybe I am.” She turns it up another notch. After a couple of minutes the sun ducks behind a cloud. Twenty seconds later Lisabeth looks pained and slows down. “I was wondering how long you were going to keep that up!” Amanda says, slowing down herself. “I’m not THAT competitive, but ....” Lisabeth doesn’t want to stop but she does too, suddenly feeling as though she’s run through her extra burst of energy. Amanda leans toward Lisabeth and says quietly, “Were you checking out that guy? I could swear you looked interested in him.” “Umm, no. Not really.” “His name is Toby Roberts. He’s pretty good looking, I’d say, and I’ve heard he’s kind of nice, though a bit stuck on himself.” “I’m not interested in Toby,” Lisabeth insists, realizing immediately afterwards that she should have said she’s not interested in guys. But she didn’t say that and doesn’t correct herself. “What do you want to do next?” Amanda asks. [FIND HIM. WE MUST LEARN WHAT MAKES MALES STRONG.] [That's obvious. Their hormones. Testoserone and stuff.. Steroids. They help them build bigger muscles, bsut it makes you look like a man too. Hairy, blocky body. Deep voice. Rough skin. Ugh!]] [A PUZZLE] “We could do some free weights,” Amanda suggests. “Not yet. I wouldn’t get enough out of it yet,” Lisabeth says. “Huh?” Amanda says, puzzled. “Until I ....” Lisabeth is confused. What exactly was she saying? “I’m sorry. I have to see ... someone.” She walks away, then turns back. “I’m sorry. I have to go. I’ll ... see you later.” She walks away quickly to the locker room, where she showers, dresses and then starts fixing her hair, quickly getting frustrated with the limited toiletries she brought with her. “Lisabeth. What’s wrong?” Amanda asks, sounding very concerned. She quickly reads Lisabeth’s expression. “OK. I won’t ask questions. Let’s go back to my room, ok?” Lisabeth follows her across the quadrangle. “You can tell me who it is who’s gotten you so hot and bothered.” Lisabeth shakes her head. “I can’t. Not ... now.” “All right. THIS time. This would look good in your hair.” Lisabeth nods. She looks around and sniffs and reaches for one of Amanda’s scent bottles. “Sure. You can use some of that.” Lisabeth holds it tentatively. Amanda takes it out of her hand and sprays some on Lisabeth’s temples and dabs some on her wrists and neck. “It is a boy. I can tell.” Lisabeth’s mouth is set. “I won’t tell anyone. Do you want me to do your face? You probably don’t have much practice.” Lisabeth nods. “I’ve never seen you like this. When they fall, they fall hard. Ok. I won’t tease you.” She works silently on Lisabeth’s face with her supplies of makeup, mascara, lipstick and coloring for several minutes. “I wish I had your cheekbones.” Lisabeth smiles briefly and kisses Amanda on the cheek then, after a brief hesitation, kisses her full on the mouth, using her tongue. “Hey! I don’t go that way!” Amanda protests, but not with too much heat. Lisabeth is looking intently at Amanda, almost as though she is inspecting delivered goods, then snaps out of it. “I’m sorry. I ... I just had to do that.” “OK. You’re welcome. Just remember. It’s not what I’m about, ok?” “Yeah. I know. I’m sorry.” She checks her lips. “I messed it up, didn’t I?” “Just a little. Let me show you how to fix it.” Lisabeth sits obediently, watching Amanda. [STRONG CHARACTER. QUICK MINDED. INTUITIVE. GOOD EYESIGHT. MANY ATTRACTIVE CHARACTERISTICS.] [Yes. Amanda’s great.] [BUT NOT LARGE. NOT VERY PRETTY. FILTERING.] ABXCTAAGATCAATGATT.... [What?] “Lisabeth!” “What?” “You did it again. You’re so spacey this afternoon.” Lisabeth sighs. “I know.” She looks at herself carefully in the mirror and smiles. “Thanks so much, Amanda. You’re so generous. Do you know where the football team practices?” “Try ... the football field?” Amanda says, laughing. 14 Lisabeth is trying not to think about what she is doing. Her heart is beating rapidly, whether from excitement, or fear, or confusion, she cannot tell. She feels a tingling in her eyes, a sharpness about her. [FASTER] She continues more quickly. She’s never been to the football field before and stops at the campus map board. She reaches for her glasses, but she can read the street names without them. Strange. She blinks, surprised, and puts her glasses back in the case unused. She’s nearly there. She walks more quickly, feeling the pleasant flush on her cheeks. There he is. Instinctively, and unconsciously, she unbuttons the top button of her blouse. And then one more. “H-hi Jock!” she says. “Uh, going to practice?” He turns around and looks at her, his eyes taking in her face and then dropping down further, pausing at her chest, darting around, reading her defenses, assessing her height, mass and weight, calculating her availability. Nice package. Beddable. He nods. “Hi. Gotta go with the team,” he says, indicating the changing room. He turns around and walks away. Pauses. Turns around. “You’re -– “Lisabeth. Lisabeth Collins.” She smiles brightly and bats her eyes, turning her shoulder slightly, letting her blouse open more, twisting her hip. Waiting. “I seen you. Yeah,” he replies and turns around to go to practice. She watches the door close behind her. Several players brush by her. She backs away, suddenly horrified, ashamed, humiliated. Her eyes water. She wants to wretch. She wants to scrape the makeup and lipstick off her face. Start with that, and then her skin. [WE NEED MORE.] Lisabeth stops herself. [What?] [WE ARE ATTRACTIVE. WE NEED TO BE MORE SO. MUCH MORE. THE MOST.] Lisabeth turns and looks again at the closed door to the training field. Calmer, even more determined, another idea takes hold of her. She leaves campus and walks into town. They are always at Starbucks. She sees them every time she has to go into town. And there they are. She walks in and glances over at the three of them, sitting on the couch, chatting. An aura of boys surrounds them. Around the boys, an aura of desire, its fulfilment held in check by propriety, by fear, by the certainty of rejection. Lisabeth flushes. Everyone there wants to be close to her. Wants to touch her. Wants to bed her. Or wants to be her. Lisabeth gets a mint tea and positions herself nearby, glancing at Missy from time to time, listening to the chatter. Tina leans over and whispers in Missy’s ear. Missy turns around and looks at Lisabeth. Her eyes focus on Lisabeth for a moment. Tina nods. "What are you doing?" Missy asks, looking right at Lisabeth. "Looking at you," Lisabeth says simply and honestly, gazing into Missy's blue eyes. Her eyes dip to Missy's wondrous breasts. She wants them. "You're gay, aren't you?" Missy asks, slightly repelled. "Yes," Lisabeth answers. Her eyes are drinking Missy in, drowning in Missy. "We adore you," she lies. "We all do." Missy looks shocked. She tries hard to look displeased. She pulls her blouse down, tightening it over her bust protectively, instinctively tuning the feelings of the boys around her to a still higher pitch, at ease in their aura of desire. "That's SO disgusting," Mary Elizabeth says, catching Missy's drift. "You know what they DO?!" she asks, her face screwed up with horror. "DO you?" Lisabeth asks, provocatively, stepping closer. "Oh, I can well imagine, thank you very much!" Tina replies. "You really think you can?" Lisabeth says, moving still closer, her eyes fully open, almost smoking, never leaving Missy’s, whose gaze, uncharacteristically, has remained on Lisabeth’s for more than five seconds. Lisabeth’s eyes travel slowly around the room and then return to rest once more on Missy’s. She exhales contempt for everyone else in the room and adds, icily. “You really think THEY know what to do? What it TAKES? What YOU need for yourSELF?” Lisabeth’s hand slowly moves to the side of her chest and then gently wanders down to rest on her hip. Her fingers flutter. “I mean, how COULD they?” “Well, it’s OBVIOUS what girls need! Isn’t it?” Mary Elizabeth says, her eyes rolling to the ceiling. “I mean, you KNOW what boys HAVE.” She looks to Tina and then, tentatively, to Missy, for confirmation that, indeed, there is something VERY important that boys have and girls do not. Missy is looking at Lisabeth, waiting for her reply. Instead of talking, she parts her lips slightly and shows a small part of her tongue. “I think this isn’t the best place,” she says slowly, at last. Her forefinger is at the seated Missy’s eye level and is rubbing a small stud on her belt in a slow circular motion. She puts her finger to her lips and then brings it back down to the stud on her belt, renewing the motion slightly more rapidly. Missy takes a deep breath. Her bust swells. A fine blush flows through her cheeks and down to her neck. An irresistible scent wafts through the air, flowing from no one can say where. “Do you like mint?” Lisabeth asks. “It has the most wonderful scent. I have fresh mint in my room, much better than what you get here.” She tilts her paper cup toward Missy, showing her how little of her Starbucks tea she has drunk. “Would you like to try some of mine? It really is better.” “Fresh is always best,” Missy says. She stands up. “I’m going to have some tea with,” she looks at Lisabeth uncertainly, “her.” “Lisabeth,” she says slowly, letting her tongue delicately touch the “l” and her lips caress the “b”. Their timing disturbed by the strange turn of the afternoon’s events, Tina and Mary Elizabeth stand to join Missy. “We’d love to try some too.” Missy looks at them, clearly displeased. She points with her pinkie. “I’m not sure that – “There’s just enough for two,” Lisabeth says. “You see,” Missy adds, almost taking Lisabeth’s arm, but then stops short. “I’ll see YOU two at 6:30. In the usual place.” She pushes past her retinue and walks somewhat unsteadily out of Starbucks with Lisabeth. Missy is not at all Lisabeth’s “type.” Too much body. Not enough gender politics. Not enough soul. And she would never protect her from ... others, like Jennifer does. But for now it was all she could do to keep her tongue off the pristine, hairless skin of Missy’s neck and to stop her hands from sampling the breastflesh calling to Lisabeth all the way through the complex of wires and fabric of Missy’s brassiere. A public display of affection would only frighten her. Lisabeth is nearly there, but she knows she still has to be careful. “No one will see us if we go in this way,” Lisabeth says quietly, determined to keep her distance for now. Missy shows Lisabeth a grateful smile. Lisabeth is inspired. For once, she knows just what to say. She can do no wrong. “Women understand each other,” she says, now inside the room, the tips of her fingers now resting lightly on Missy's neck. Missy shivers slightly. "Are you cold?" Lisabeth asks. Missy shakes her head. Lisabeth presses her fingers slightly harder into Missy's skin, rubbing and massaging down her back. "Nervous?" Lisabeth asks, her lips extending toward Missy's ear as she brushes Missy's soft blonde hair to the side. She nibbles the edges of Missy's ear and kisses it with feathery soft kisses and Missy shivers again, longer this time. The intoxicating Missy scent is stronger now, much stronger than it had been in the coffee shop. "You're not at all cold, are you?" Lisabeth asks, whispering now in Missy’s ear. “Oh no!” she says. “Not at all!” And then, after a pause, “Aren’t you going to hold me? Take my clothes off? Do you ... do you want to touch my breasts? Or ...” "Would you like me to?" Lisabeth asks. When Missy doesn't reply, Lisabeth adds, “I’m going to do ALL of those things,” Lisabeth whispers, "but not right away." "Boys are always in such a rush to touch them." "Well, they ARE spectacular, Missy." Lisabeth says, looking into Missy's eyes, seeing the relief that Lisabeth too thinks so. Part of her is thrilled at how easy this is turning out to be, part is excited by Missy’s amazing body, and another part, which she doesn’t quite understand, is growing more and more excited about something else, but she doesn’t know what. "But they're not going anywhere. Right? We have all the time we want. 'Til we're ready." Missy lets out a small moan. Lisabeth knows she’s ready right now, but she wants to prolong the moment. She reaches to Missy's blouse and opens one button and then another, letting the pressure from Missy’s breasts push the shirt open. Lisabeth isn’t small-breasted. Not at all. And she has slept with women with large breasts, although they were overweight and flabby. Nothing like the combination of small bones and waist, well-toned muscles and full, round, firm, flawless breasts splaying out in front of her right now. "You really like them too!” Missy said. “I’m glad. Boys are so different about them. They treat them like they’re something separate from me. But with you, it’s like you see them as part of me, something that makes ME special. You’ve no idea how that makes me feel. Like I’M unique, not just my breasts.” “You ARE unique.” Lisabeth says, releasing the third and fourth buttons with one hand, helping Missy out of her blouse and then undoing the seemingly endless row of hooks holding Missy’s brassiere together. When she finally finishes, the undergarment seems to exhale in relief at the ending of its workshift and rapidly opens, allowing Missy’s breasts to push forward, even larger and more beautiful than Lisabeth has expected. “I’m amazed they’re so round, so high, so ....” “I know. I have really good muscles, in front and in the back, and the shape and where the nipples are also ....” She stops and looks embarrassed. “Is it stupid to talk about them? I feel like I can ... because you’re a woman. You know what it’s like -- to have breasts.” "Not like yours," Missy says rubbing her cheek against Missy's billowing left breast while holding her right breast in her hand, as much of it as she can fit, that is. [NOT YET] [Huh?] "I want you to suck on it," Missy says, almost begging. Lisabeth obliged, no longer hesitating for effect. Enchanted by Missy's beauty and her obvious arousal, Lisabeth was increasingly caught in a rising spiral of desire. [K-K-KISS HER!] [I want to] [DO IT!] "Oh yes, Yes, YES!! Oh, Lisabeth, kiss me. Kiss me, please. Just don't stop touching me." Lisabeth reluctantly lifts her mouth off Missy's breast and raises it to Missy's flushed face, her lips full and red. She smiles hungrily, but first she reaches for Lisabeth's shirt and lifts it over her head. "I want to see yours," she pants. Lisabeth nods and turns to let Missy reach behind her more easily, but first pecks her lips. “You’re a tease!” Missy says happily. [MORE!] She frees Lisabeth’s breasts and cups them in her hand. “It’s nice to touch them. I’ve never touched another girl’s breasts before,” Missy says, moving them slightly as she holds them. Lisabeth is watching her carefully. Suddenly she is insecure. Is Missy really enjoying them? Or is she just glad that her own are so much bigger? So much better? [KISS HER!] Lisabeth releases Missy’s breasts and holds her cheeks, puts her mouth on Missy’s and kisses her hungrily, her tongue probing deep inside while Missy wraps her arms around Lisabeth and clings tightly to her. [OH YES, YES, YES!!] What IS it about her? She tastes so sweet. She is honey and flowers and violins. Lisabeth could kiss her for hours. [STRONG. HEALTHY. THE BLUEPRINT OF THE SHAPE. NOT TOO SMART. FILTERING] ABXCTCAATGATCCATGTGGTAGCT.... [What is happening?] [DON’T STOP. MUST PREPARE. SHE MUSTN’T BE THE SAME.] [What?] [DON’T STOP KISSING HER!] “OH!!” Missy pulls back suddenly, her knees weak. “What was that? What was .. was that IT?” “What?” Lisabeth asks, feeling a little woozy as well. “Did I just have an ... an orgasm?” Missy asks, suddenly shy, crossing her hands over her breasts. “I don’t know,” Lisabeth said, suddenly tired. She looks through her window at the late afternoon sun and feels like she wants to be outside. Needs to be outside. Missy looks drained and confused. “What’s wrong?” “I don’t know. Is that ... does it always do that?" "No. Not always," Lisabeth said. Does Missy really not know what it feels like? She feels a little sympathy for her. [DON'T] [Why] [THEY DON’T MATTER. SHE DOESN'T MATTER.] Missy reaches for her bra. “I ... I think I better go.” “No! Please not yet. We just started!” Lisabeth puts her hand on Missy’s arm, but Missy draws back. “Missy, I’m sorry you’re feeling bad. It was ... really good. There's more. Please stay.” She looks longingly at Missy’s breasts. She was much better than Lisabeth had expected. [OURS WILL BE BETTER] “It was special,” Missy says but doesn’t stop manoeuvring her breasts into her bra. Her hands are trembling. “Don’t spoil it. Just don’t ... please don’t tell anyone.” Lisabeth stiffens slightly. “If you feel that way ... I won’t.” "You understand?" Missy says, pleading. "What would people say? What would they think of me?" Hurt, Lisabeth lashes out. "They might think you were more interesting." It's a remark worthy of Amanda. Missy turns her head sharply at that remark. Her nostrils flare and her eyes flash. "I should have KNOWN you were this way!" "What way? Lisabeth says, putting her hands on her hips. "You're just like the rest of them!". Just in it for yourself. You made me think it was different but you only wanted me for my body! For my TITS! THEY'RE PROBABLY ALL YOU AND YOUR KIND EVER DREAM OF!!" Her blouse fully buttoned, she covers her chest with her hands and then slowly pulls them back, arching her shoulders, showing her profile in its most spectacular pose yet. "Well, get a good look, because THIS is as close as you or ANYONE of your kind will EVER get to them again!" "No" Lisabeth was near tears, but she blinks them away. "Just go! GO already!" Missy hears the emotion in Lisabeth's voice. Had she misunderstood? But it is too late now to change direction. She picks up her purse and flounces out of Lisabeth's room, slamming the door. [SUN. SUN WOULD BE GOOD] [How can I think about getting sun at a time like this?] [SUN WOULD BE VERY GOOD. IT WILL BE VERY HELPFUL] Lisabeth flings herself on her bed, humiliated for the second time that afternoon, and starts to cry. This is so unlike her, coming on to a boy, a football jock, no less, trying to seduce a bimbo like Missy, even kissing Amanda, whom she knows is completely straight. And now CRYING! She never lets herself cry. It reveals too much. What is WRONG with her? She feels strange too. Maybe she’s getting sick. [SUN. THE SUN IS WEAKER.] [PLEASE. THE SUN.] [Why do I need the sun? What am I, some kind of sun bimbo now?] [NO] Lisabeth can’t go out like this. She pulls herself together, blinks away her tears and starts to get dressed. [LEAVE THAT OFF. UNCOMFORTABLE] [Not wear a bra? That is so Seventies! Well, just this once. Why should I care how I look now!] She pulls on a t-shirt, runs a brush through her hair and staggers outside, looking for a place she can sit in the sun and not be bothered. She finds a bench behind the dorm, leans back and closes her eyes. It actually feels good. She pulls her sleeves up to her shoulders, opens up her midriff and exposes as much of her legs to sun as she dares. Her mind wanders. [WHAT IS SO ATTRACTIVE ABOUT MISSY?] [Huh! What isn’t? Except for her obnoxious self-centered what-would-they- think-of-me bimbo attitude.] [FILTERED OUT. SHE IS TALLER. IMPORTANT?] [Sure, I’ve always wished I were taller. 5’9” is much better than 5’5”! Especially with her longer legs.] [UNDERSTOOD. SCENTS, TASTE, ODORS NOTED, AS WITH POLLEN FROM BEES] [Huh? I’m really having the strangest thoughts today.] [SUPERIOR IMMUNITY IMPORTANT. OTHERWISE SCENTS HAVE NO IMPORTANT SURVIVAL IMPLICATIONS. MORE ATTRACTIVE SEXUALLY, ALTHOUGH ALSO TO INSECTS. BALANCE PRIORITIES. ATTRACTIVENESS MORE IMPORTANT.] [Than bugs? Sure.] [BREASTS.] [Huh? I don’t really want to think about them now.] [IMPORTANT. HER BREASTS. MISSY’S BREASTS.] Lisabeth shifts in place on the bench, crosses her legs. Sighs. [Thinking about hers makes me so hot. They were amazing. A dream.] [ACCEPTED. NOT UNDERSTOOD. AROUSAL A PUZZLE.] [Not really. Just one of those mysteries. A pleasant one. Except when they leave too soon!] Lisabeth’s hand drifts down to her crotch. [Ooops. Not here. I almost forget where I am.] [UNCOMFORTABLE] [Yeah, when you want it, you need it, but I’d have to go inside to ... heh- heh. Sun feels so good.] [SUN IMPORTANT. NEED ENERGY FOR TRANSFORMATION. BUT ALSO NEED “HEH-HEH”. BALANCE PRIORITIES.] [What am I talking about? I mean, thinking?] [TRANSFORMATION OF DNA THEN CELLS, ORGANS, PHYSICAL PROCESSES AND BODY TO MAXIMIZE POWER AND SURVIVAL. ALSO “HEH-HEH”. AND "HEH-HEH" WITH BOYS. LIKE AMANDA. LIKE MISSY.] [Heh-heh? Sex? Enjoyment? Fun? What am I thinking?] [TRYING TO UNDERSTAND THAT ... “FEELING” BEFORE. PUZZLE.] [Transformation?] Lisabeth suddenly notices her t-shirt is feeling a bit tight. She opens her eyes and looks down at stretch marks in the cloth across her chest, aroused erect nipples clearly visible against her skin-tight shirt, the shirt nearly overflowing with breasts. “What the – She stands up and sees that her pants have ridden up her thighs. They feel tight. She feels all off balance, higher off the ground, and starts breathing rapidly, panicked. [What’s happening to me?] [TRANSFORMATION. NOT FINISHED YET. SUN WEAKENING. NEED MORE.] [I’m going crazy! Why do I keep thinking about the sun? What does the sun have to do with all this?] She is walking quickly inside to her room. [SUN PROVIDES ENERGY. NEED MORE TO CONTINUE GROWTH AND TRANSFORMATION.] [Who am I talking to? Am I talking to myself?] [WE ARE TALKING TO WE] [Who is we? I’m Lisabeth.] [WE ARE LISABETH] She is inside her room and pulls off her t-shirt. She almost falls over seeing the large, absolutely gorgeous breasts that spill, spring, burst, out from her chest. [VERY ATTRACTIVE NOW] [My God!] [GOD?] [They’re ... they’re like Missy’s. So round and ... pert. Not as large --] [NOT FINISHED GROWING. STILL CHANGING. NEED MORE SUN.] Lisabeth looks at herself in the mirror. “I’m taller too.” [NOT FINISHED GROWING. NEED MORE SUN.] She falls down on her bed and starts sobbing. “What’s happening to me?” she cries out. “This is impossible! My thoughts are making no sense. I’m going crazy!” [NOT CRAZY. IMPROVING. MORE ATTRACTIVE. STRONGER. FROM HER. THEN FROM HIM TOO. STRONGER AGAIN. LISABETH WILL BE POWERFUL. WILL SURVIVE AND GROW.] [I’m improving? I’ll be powerful?] [VERY POWERFUL] Lisabeth feels calmer. She doesn't know why. It seems easier to handle, somehow. The voice MUST be her, a part of her she never knew. It's the feeling that made her feel less alone before, just after lunch. The feeling that frightened her for just a moment, but it is with her, is for her, will help her. She always felt she was special, without knowing why. Now she knows it. Who cares about what Missy said or did! She looks down at her chest. A thrill flows through her, seeing her breasts, like Missy's breasts. Spectacular. [I’m special.] [LISABETH SPECIAL. VERY SPECIAL] 15 There is a knock on the door. It’s Jennifer and two other friends from the gay clan, Crystal and Vrema. “Lisabeth, are you in there? Are you coming for dinner?” Lisabeth has been playing dress up for the past hour, but can’t find anything to wear that does justice to her new body. In fact, there is nothing she can wear without looking completely indecent. She is half- tempted to hide silently in her room, but too hungry to skip dinner. “I’m here,” she says. “But, uh, would you, um, not scream when you see me.” There is no response. “Please promise.” “OK,” respond three voices, all reluctantly. “It’s just us!” Lisabeth opens the door a crack and lets them in. It’s all they can do not to scream. “What’s HAPPENED to you!” Crystal says, a short, curvy girl with a cute face, freckles and an infectiously happy smile. “You’ve always looked good, but you’re gorgeous tonight!” Jennifer looks at Lisabeth with a little scepticism and a great deal of envy. “I’d think you just had a boob job, if I hadn’t seen you at lunch. What gives?” “I don’t know!” Lisabeth says, pretending to be upset. “Growth spurt?” Vrema is looking critically at Lisabeth’s clothes. “I’ll say! You’ve completely grown out of this top. You look silly.” “Worse than silly, actually,” Jennifer says. “Every guy is going to be staring at you. You know what they’re like! It’s going to be SO annoying to BE with you!” Crystal sidles up to her and rubs sensuously against Lisabeth’s rounded hip. “Oh, I don’t know. I LIKE Lisabeth this way!” She leans into Lisabeth’s cheek and rests her mouth and nose on it. “What IS that scent? Why, I CAN'T resist you!” She wraps herself around Lisabeth's body and hugs her. Jennifer glares. Lisabeth smiles for the first time and puts her arm around Crystal to hug her. “Thanks, sweetie.” “Ooooh! Strong hug!” Crystal giggles and lets go. She sticks her tongue out at Jennifer. "Jealous!" “You’re so hopeless with clothes!” Vrema says, looking at the pile of discarded tops on Lisabeth’s bed. Lisabeth shrugs helplessly. “I just don’t have your talent with styles, not to mention a needle or sewing machine.” [THEN KISS HER] [Vrema? Why not?] Vrema sighs. “Then I suppose I’m going to have to fix you something, if we’re EVER going to get to dinner!” “Oh thanks, Vrema!” Lisabeth says. She grabs Vrema and kisses her on the lips, ignoring Vrema’s prudish protests and easily resisting her attempts to push her away until she hears that inside voice. [DONE. FILTERING.] ABXATTCGAATACC .... “Jeez, Lisabeth, you KNOW I hate being pulled,” Vrema says crossly. “I’ve half a mind to let you go out like this.” “Oh please, Vrema!” Lisabeth begs, bending over slightly and twisting her hips. “You KNOW you’re the only one who can help me!” Vrema sighs. “Well, for you!” She takes her ever-present sewing kit out from her purse, rips up a couple of Lisabeth’s blouses and expertly reworks them to accommodate Lisabeth’s larger bust. Lisabeth watches carefully. She has never had an aptitude for sewing, but the quick movements of Vrema’s fingers make sense to her, like she’s just learned how to read. “Can I try?” Lisabeth asks, when Vrema is half done with the second blouse. “Please! We’ll be here all night!” Jennifer complains. “And I’m supposed to be leading a discussion at the Women’s Guild at 8.” Lisabeth has already taken the needle and is working the seam. “No, you need to push ... that’s it. Yes, tighten. You’ve got it. That’s really good. I’m amazed.” Lisabeth’s fingers are moving more and more quickly as she gains confidence. “It’s fun.” “I could show you some work with patterns if you like after dinner. It’s much more fun than this. You can be very creative.” “Oh, I’d really like that,” Lisabeth says brightly. “But maybe not tonight.” “Sure. Besides, you’d probably want to get your own patterns.” “Oh, I’m sure I will,” Lisabeth says, nearly finished. She puts the blouse on, and buttons it. Jennifer clears her throat. “You ARE going to wear a bra, aren’t you?” Lisabeth rolls her eyes. “You think any of THESE fit?” she asks, holding up her 34-C bras. “I haven’t exactly had time this afternoon since my growth spurt to get new ones.” “At LEAST wear a t-shirt underneath then! Really Lisabeth! I don’t know what’s gotten into you. You’re flaunting your body like you’re ... like you’re that horrible Missy Marshall!” "Is THAT who I make you think of? Please!" Lisabeth begs. "Not her!" "Don't worry, Lisabeth! No one could mistake you for Missy!" Vrema says reassuringly as she puts her sewing kit away. "Absolutely not!" Crystal echoes, putting her arm through Lisabeth's. "Hey, let's eat!" 16 "She said 6:30." "At the usual place. We always eat dinner at the North Hall." "Not always. But usually." "I said usually." "You said always." "I meant usually." "But you said -- anyway, what should we do?" "Maybe we should call her." "What if she doesn't want to be interrupted?" "What if she's wondering where WE are?" "If she's wondering where we are, then she would call us." "Unless she doesn't have her phone." "But then there's no point calling her." "Unless she's just late." "Or we're the ones in the wrong place." "And she's waiting for us." "Getting madder every second." (Pause) "We'd better call!" they say in unison. "You call," Tina suggests quickly. "No, you!" Mary Elizabeth counters. "She likes your phone voice better." "I called her last time. Besides, my phone is almost out of power." Tina glares at Mary Elizabeth. Outsmarted again. "Ok. But you call her next time. I'm keeping track!" Mary Elizabeth sighs "whatever" while Tina pushes the buttons on her phone, slowly, hoping she'll see Missy and can stop. But there's no sign of her. "It's ringing. And ringing." "Maybe her phone is off" "No. It wouldn't be ringing." "Maybe she doesn't have it with her." "Maybe. ... but then wouldn't -- "Oh yeah! Maybe -- Tina waves frantically to silence Mary Elizabeth. "Hi! Missy! Yeah, we're, you know, at the North Hall and ... You were sleeping! My God! I'm SO sorry. If you ... yeah it's a quarter to ... Mary Elizabeth said ... well we didn't know if we should ... Ok. We'll be RIGHT there!" Tina clicks the phone closed and they immediately leave the dining hall and hurry to Missy's room. "Was she angry?" Mary Elizabeth asks anxiously. "I don't know. She was ... kind of groggy." "Of course she was! What do you expect? She was sleeping!" "I know THAT. I was the one TALKING to her!" They race to Missy's door and knock. There's no answer. They knock again and hear a groan. "Yeah? Who -- "It's us!" Tina and Mary Elizabeth say together. They wait. For nearly a minute. Mary Elizabeth squeaks, "Missy?" They wait. And then knock again. "Be ... right ... there." There is shuffling of feet and the lock is undone. The door opens slowly. Tina and Mary Elizabeth pause, waiting. "Come in," Missy says, opening the door more. Her hair is mussed. Her blouse is half-unbuttoned, slept in. Her make-up is smudged. Tina and Mary Elizabeth enter quickly and close the door. They look her over, unsure what to say. "What did she DO to you?" Mary Elizabeth finally squeals. "You look awf -- awesome, as usual, but just a little er," she looks to Tina for help, which Tina decides not to give, "er, untidy," she finishes, awkwardly. "Just a bit tired," Tina says, triumphantly. "I'm exhausted!" Missy says, yawning. "Ever since I kissed, I mean, kicked that little lesbian bitch out of here." "I thought you went to her room. For tea." Mary Elizabeth says. Missy blinks, too tired to answer. "That's what she said. Obviously they changed their minds!" Tina says, scoring yet another point. Mary Elizabeth looks daggers at Tina. "I'm not sure," Missy says. She sighs and pulls helplessly at her blouse. "I hate this blouse." "Wasn't that the one Tina found for you?" Mary Elizabeth asks, innocently. "It just needs ironing. I'll do it for you later!" Tina says, helping Missy out of it. Missy nods, her eyes still glazed, while Tina and Mary Elizabeth look down to admire Missy's flawless skin, noticing for the first time two nearly infinitesimal folds of skin at her waist. Missy sighs and wanders over to her closet. She stares at the rainbow of blouses and carelessly chooses one and pulls it on. Her fingers fumble at the little buttons. "I'll get that for you, Missy!" Mary Elizabeth says quickly. "You must still be tired." "I wonder if that lesbian bitch DRUGGED you!" Tina says darkly. Mary Elizabeth struggles with the buttons too. "You're not doing it right," Missy says, annoyed. Something about the way the blouse fits across her chest isn't what it should be. Missy fusses with the shirt, pulling it and pushing it into place, her expression becoming more cross with each tug of her fingers. Tina and Mary Elizabeth wait helplessly. "Um, they, er, close at 7:15. We'll miss dinner if we don't, you know," Mary Elizabeth says tentatively. Tina shakes her head. "What's more important, Mary Elizabeth, eating or how we present ourselves?" "Oh, this thing is so stupid!" Missy says crossly. She is hungry, perhaps due to her eating only half of the muffin at lunch. "Let's just go!" Mary Elizabeth smiles in triumph. They walk out quickly, trying to get back to the North dining hall before the line closes. Missy is half a step behind them, feeling breathless, tugging at her bra strap, which seems to be loose, still trying to fix her blouse. Heads turn as the girls hurry, the boys unable to resist the view of Missy's breasts furiously jiggling as she strides by. They reach the dining hall with five minutes to spare, but Missy slows to catch her breath, her chest heaving, her bosom bouncing rhythmically. The cry, "Come on, already!" escapes Mary Elizabeth's mouth before she can stifle it. Missy glares at her. “Oh, I’m sorry Missy. I know you just woke up. It’s just that dinner’s almost over.” “We’re fine,” Tina says, as the three of them now wait their turn. “Not that there’s much of a choice left.” “I’ll have the salad.” Mary Elizabeth says quickly. "It looks good." “Me too.” Tina echoes. "That's all I need." Missy is staring at the macaroni and cheese, her eyes dancing over the rich sauce. She can taste it already. She knows she should pass it by, but to the amazement of Tina and Mary Elizabeth, she starts taking some and finds she can’t stop until there is no room for the broccoli, spinach and carrots further down the line. She puts the plate on her tray and then starts taking some salad on a small dish, but can hardly put a few greens on a plate before stopping. The chocolate muffin looks so much better. And two look better than one. The thought occurs to her that the blueberry muffin might have been better, and she thinks back to the half-muffin she left behind at lunch. Maybe if she had eaten the whole one then she wouldn't be so hungry and woozy now. Maybe if she had -- “Missy … are you feeling all right?” Tina says. Missy nods. She doesn't want blueberry now. She wants chocolate. 17 Meanwhile, on the opposite side of the room .... Jennifer is very angry, Lisabeth coolly defiant, Vrema tensely quiet and Crystal somewhat frightened and looking back and forth between her bickering friends. Chicken bones are scattered on Lisabeth's plate and tray. "I just think you should have discussed this with me first," Jennifer is saying. "I don't see why my eating habits are something I have to discuss with you," Lisabeth replies. "Well, because, it changes everything." "It doesn't change anything." "It does. Consuming animal meat changes you." "That's ridiculous." "It's true. I bet this isn't even the first time she did it," she adds, looking conspiratorially at Vrema and Crystal who look over to Lisabeth. Lisabeth shrugs. Jennifer nods vigorously and looks to Crystal and Vrema for support. Vrema is looking at Lisabeth and the stretch marks on the blouse Vrema had altered appearing around her bust. "Except maybe her top isn't fitting so well. I could have sworn I'd measured you correctly before." "Um, to be honest guys, I think she looks great," Crystal says tentatively, reluctant to contradict the fierce Jennifer. "I'm talking about what's inside!" Jennifer declares. "Consuming animals is changing her whole system. And NOT for the better, whatever your conventionally sexist eyes are telling you, Crystal!" "Excuse me." Four female heads whirl at the unexpected intrusion of a male face at their table. If possible, Jennifer's eyes narrow even further. "Didn't you, uh, come by to uh ..." he stammers, his eyes finding it difficult to stray from the breasts straining against Lisabeth's blouse, pushing insistently for more room. "You are NOT excused! Can't you see your gross male aggression and infantile breast fixation are not welcome at this particular part of the campus?" Jennifer snarls, trying to keep the boy away from them, and especially away from Lisabeth. Jock turns his head slightly in Jennifer's direction and then decides to ignore her. His eyes never leave Lisabeth blouse. "You're Lisabeth? Lisabeth Collins, right?" [IT'S HIM. YUM.] "I am," Lisabeth says, unsure of herself. [BIG MUSCLES. LOOKS STRONG. WANT MORE STRENGTH.] [I don't like boys.] [HIS STRENGTH VERY GOOD. HE WANTS LISABETH. WE ARE MORE ATTRACTIVE NOW. WE ARE ... SEXY] Lisabeth looks at Jock's face. He Isn't ugly, although his hormonally charged desire-laden expression make her a little frightened, but when her eyes drift down to his broad shoulders, his bulging biceps and flat stomach she shudders with want. The exact nature of her want escapes her, but it's something he can satisfy. Her eyes focus in on his mouth, his so, so very kissable mouth. It was all she can do not to reach up right then, put her arms around his neck, pull him down and kiss him. [KISS HIM] [I can't kiss him here! Not like this.] [KISS HIM] "Um, could I talk to you a minute?" Lisabeth is almost shaking with excitement. She turns to her friends. "I'll be right back," she says, to their amazement. She puts her hand on Jock's arm and pulls herself up, her chest brushing slightly against his arm. He looks down at her, watching her breasts bounce and rearrange themselves inside her blouse and waits, politely. It would not be right to continue with any further movement or conversation until they stop speaking to him. "Uh, sure. I'm with, you know, the guys." He points over to his usual table, where Duane, Carlos and Bud suddenly stop eating once Lisabeth stands up and are now watching her intently. "I, uh, never noticed how, uh, good- looking you were. Are you new here?" "She's gay, you know," Jennifer calls out, helpfully. Still holding onto to Jock's arm, Lisabeth pivots, stretching her blouse even more tightly than before. The newly sewn buttons strain against the thread. More heads turn, waiting, hopefully, but thanks to Vrema's expert needlework, the blouse remains fastened. "No," Lisabeth replies, walking with Jock toward the exit. "They just said you're -- "I ... I am finding you VERY attractive," Lisabeth says, overcome, hanging onto Jock more tightly to support herself. They pass Missy, who is now enjoying her third chocolate muffin, while Tina and Mary Elizabeth wait in amazement, having finished their salads long ago. "Hey, isn't that the girl in the coffee shop?" Mary Elizabeth says. Tina turns her head. "Who?" "The, you know, the lesbian. The one who -- Missy wipes her mouth and looks, then returns to her muffin. "She's with Jock!" Mary Elizabeth continues. "What would Tammi say!" "Funny, she kind of looks a little different. Like she's padding her bra." "She's not WEARING a bra," Tina says. "She's gonna ruin herself going around that way!" Jock and Lisabeth pass around a corner, suddenly in a private place, and Lisabeth pushes against his crotch, feeling the strange, pulsing bulge in his pants. She wants to run away from it, but her strange desire won't let her leave him. "Do I LOOK gay?" she asks, leaning backwards. "No. Well ... I never thought that ...." She is dazzling him. Her tits are fucking amazing. How could he have not noticed them before? She's almost as good as -- he is having trouble remembering her name. Right. Missy. He has a dim recollection of seeing her at dinner but can't quite recollect. But damn, this girl is almost as hot. And she's right here. And she's coming on to him. He puts his hand on her ass. Really tight and round. "Hey, we could go back to ..." Fear washes through her. What is she doing? [KISS HIM] [I can't do that.] [KISS HIM. YOU MUST KISS HIM.] "My friends will think ...." "What!" he says, wondering if this is some kind of game. A trick. He pulls away slightly. [KISS HIM!!] "NO!" she says, leaning further back. He is holding her up now. Oh, why won't he kiss her already? Her lips purse. He's staring at her, unsure. "Won't you kiss me?" she says. He's got to feel those tits. He's got to make sure they're real. "Kiss me!" she repeats. She stretches higher, seeking his lips. He squeezes her ass harder, pulling her against him, grinding her against him and with his other hand reaches for her chest. My GOD! They are real! And they're HUGE! "Kiss me!" she begs. He's got to see them. He eyes rise slightly into her face. What is she saying? "Jock, please, please, please kiss me." If that's what she wants. He bends down slightly and puts his lips on hers. She brushes his lips and he withdraws. She pouts. He sighs. He bends down again. Kissing is such a waste of time. She presses harder against his lips, but his mouth is closed. [NEED MORE] She is trembling. Desperate. What IS it with guys? In a flash of inspiration, she undoes one button, takes his hand and guides it inside her blouse and under her t-shirt. 'Oh GOD!' he thinks and his mouth opens, involuntarily, as he mentally begins to suck the huge round tits his hands are groping. Lisabeth immediately attacks his mouth just as hungrily as he is imagining what to do with her breasts, probing with her tongue, sucking at his juices. [AAAAHHHH] Lisabeth stiffens and then relaxes suddenly, just as Jock is grinding at her more insistently. What is he DOING? UGH! She tries to pull back but he is too far gone to stop, and far too strong for her to break his hold on her. "NNNNGG. NNNGG." he says into her mouth as his powerful pelvis pushes against her, practically lifting her into the air. His hand claw painfully at her breasts. And then he stops. He is breathing hard. "Man!" he says, satisfied. "You are one hot babe!" He releases her. She nearly falls before she catches herself. His hand is still inside her blouse. He pulls it out, reluctantly. "And I have to tell you, those are great tits you're growing." She can't quite believe what she's just done, what he's just done, what she has just heard him say. She quickly buttons her blouse back up and runs her hand down her front to smooth it, encountering an unfamiliar sticky substance. Her face screws up in disgust. "Heh. Sorry." He laughs. "Can't help it," he says proudly, pulling at the elastic waistband of his sweatpants. "Mr. Dick's big and strong. There's no holding 'im back!" She moves to wipe his cum onto his shirt but he catches her hand, holding it back easily. "Hey! No need to mess ME up. You know?" She looks down at the glistening material on her fingers. [INGEST. EAT. QUICK.] [Eeewwwww] It disgusts her, but it also looks as appetizing as anything she's ever seen. She slowly raises her hand to her mouth and begins sucking on her fingers. "Hey! THAT'S the girl!" he says, suddenly very impressed. "You're a funny one, you know. If I'd known you were that, you know...." [WOW WOW WOW WOW] Lisabeth's eyes are slightly glassy. "Um, well, yeah. My friends are ...." She looks down at her still stained and sticky blouse. They can't see this! "I have to go!" she says abruptly, and hurries back to her room, taking a back route through the darkened campus. Once there, she presses the fabric to her mouth and vigorously sucks up every trace of Jock's cum. [WOW WOW WOW ELEMENTAL WHOLLY POTENTIALIZED COMBINATIONS PROCESSING FILTERING] [Huh?] [GOOD FOR LISABETH] [Good? I can't believe I did that.] [PERFECT. WONDERFUL.] She puts on another t-shirt. It's way too tight, but she looks at herself in the mirror, running her hands over the amazing curves she has, all of a sudden. [Strange. Disgusting. Animal. What does he see in this? He was so desperate. Kind of funny. So different from girls.] [IS THAT CUTE?] [I don't know. I can't believe I ate his cum. Uchh!] [ELEMENTAL MATERIAL. HIGHLY CONFIGURABLE.] [Yeah, elementary, configurable. That's boys for you.] [VERY STRONG] [Jock was scary strong. That's one thing I don't like about boys. They're too strong.] [LISABETH WILL BE STRONG. SCARY STRONG.] [Yeah, I wish!!] [CONFLICT. HORMONES. MASCULINE. STRONG. FEMININE. CHARACTERISTICS CONFLICT. PUZZLE.] [What? The differences between girls and boys. Sure. The price of our being the superior sex. They get the muscle.] [RECONCILE. INNOVATE. MAKE LIKE JOCK? SHAPE CHANGES. SKIN. HAIR. NOT ATTRACTIVE. PUZZLE. [Sure girls can be strong. It would be great if I could be myself and be as strong as Jock!] [YES. FEMININE STRONG. MAKING BETTER. COMBINING. INNOVATING.] ABXCTAAGATCABXATGATT.... Without knowing why, Lisabeth looks out the window, yawns and sighs. She opens a book to study and then closes it. Light day of classes tomorrow. She can study tomorrow. She doesn't hear the ringing of the telephone or the loud knocks or, finally, the voices outside saying, "She must have gone somewhere with Jock. I can't believe it! I just can't BELIEVE it!!" It is just past seven. Lisabeth's eyes flutter open as the sun turns the corner and slips into her room. Why is she awake? Her first class doesn't start until 11. [SUN] [Of course it's sunny. It's always sunny.] [GO OUTSIDE. MORE SUN THERE] She stretches and pushes herself half off the bed. Her body feels light, but there is nothing light about the breasts that sit on her chest. [Oh yeah. Breasts] [LOVELY. NOT LARGE ENOUGH] [They are so! I don't need to carry anything bigger!] [WE ARE STRONG ENOUGH. WILL BE STRONGER. SOON. THEY MAKE US ATTRACTIVE, SEXY. BUT NEED SUN, MORE SUN] Lisabeth sighs. The sun does look so inviting. [I'd love to, but it's not healthy. And I have class later.] [SKIP IT] [But I should go.] She looks outside again. The sun fills her with longing, almost hunger. [Well, maybe I can skip this morning's. Nothing that important.] She reaches for blue jeans. [NO! SHORTS] [Maybe the jeans are too tight.] She puts on an old pair of shorts. She feels barely decent. Her legs look awesome She pulls on her t-shirt, which feels tight and barely reaches her navel. [WEAR LESS.] [I am not going out in a bra!] [T-SHIRT TOO TIGHT!] [No! What's coming over me!] Satisfied that she had silenced the "other voice" she takes her books along and finds a private place to sit. The sky is pure blue. The sun pours down on her, unimpeded. She relaxes for a moment. Then she thinks, [Sunscreen?] [WE DON'T NEED IT] [This again! I burn instantly.] [NOT NOW] [Maybe not this early. I'll have to get it later.] [WE'LL SEE] The sun makes her body tingle. As it rises the feeling gets stronger. Eyes closed, she turns toward the light, facing the sun full on, rolling up her shirt to expose more of her skin to the pleasant heat, wishing now she'd listened to her other voice and worn less, although soon her shirt is folded up to just below her breasts. She lies quietly, her mind empty, thoughts flitting through randomly, the usual worries silenced. [Bikini wouldn't fit anyway. Not with ... these! Hmmmp! This is a good spot. More sun, yes. Warm. Comfortable. Mmmmm. Turn a little. Yes. Ooooh, tingle. Am I burning?!] She cracks her eyes open enough to look at her skin. It's warm to touch but not red. Her watch reads 10:30. She closes them again. [Could go to class. But already decided I'd skip. So comfortable here. Feel so good. So relaxed.] "Lisabeth?" "Hmm? What?" She opens her eyes. "Crystal? Amanda? Jennifer?" She cranes her head around. "Valerie?" "What are you doing? We were worried about you!" Valerie says. "You missed my Women's Guild meeting. Then class. And lunch. Where have you BEEN? With that ... that BOY -- Jock?! Did you sleep with him?" The image of Jock flashes through Lisabeth's mind along with a mix of feelings she doesn't quite understand. "Umm, no. No I didn't," she says, heatedly at first. But then adds, "But I might have ... if he were -- Jennifer is shocked. Amanda is suppressing a smile. Valerie looks confused. "Are you still gay?" Valerie asks. " -- a complete human being," adds Lisabeth to finish her sentence, looking at Jennifer. She ignores Valerie's question, instead asking, "Could you move just a little bit? You're blocking the sun." "Do you know what time it is?" Jennifer says. "It's nearly five o'clock! Have you been out here all day? What's wrong with you?" "Nothing!" Lisabeth says, annoyed at Jennifer's tone. Was she always so very bossy? "It's five? Really?" Lisabeth stretches, grateful that Valerie has moved. "Wow. I feel good." She feels like her blood is crackling with an unfamiliar energy, yet she's also feeling hungry. She slowly stands and looks around, slightly confused. "Did you all shrink?" she asks. The tallest of the three, Jennifer, at 5'7", barely reaches Lisabeth's neck. "You must be six feet tall!" Valerie exclaims, the shortest at 5'2". "What's happening to you?" "And sexy as all get out," Crystal adds, looking hungrily at Lisabeth's breasts pushing hard against the thin band of her t-shirt. She licks her lips and inclines her head toward them. "Crystal, you are such a slut!" Amanda says with a smile. "I know. And I'm cute too," she replies. "You're not bad either, Amanda, though I know you don't go our way, but Lisabeth here," she sighs, "today she's a goddess. A sex goddess." She leans onto Lisabeth's chest and sighs. "And she smells like heaven too." [PLAYFUL. FUNNY. MORE THAN WE ARE, EVEN AFTER AMANDA. VERY USEFUL] [Huh? I'm playful!] [NOT LIKE HER. KISS HER.] [But Jennifer will --] [KISS HER.] "Lisabeth! Hello? Are you sure you're all right?" Valerie asks. "She was being like this yesterday," Amanda says, "Very distracted. Maybe it's growing pains." Lisabeth looks down at Crystal. She seems so small, her lips so far away. She had hardly felt the weight when Crystal leaned against her, and she's so sweet, bubbling away. Not really thinking about it, she puts her arms around her and casually lifts her up to her lips. Crystal makes little squeals of delight until Lisabeth kisses her and then Crystal wraps her legs around Lisabeth's waist. "Oh, wow!" she says, when Lisabeth breaks it off. She puts her head on Lisabeth's shoulder, deliriously happy. "Sweeter than honey! And so strong!" she chirps. ABXGATTCACAGGAACBXTGATT.... Lisabeth looks around. The world loses its harshness and takes on a warm glow. It loves her. She relaxes and starts to smile -- at first a very small smile. She can see now that everything here is for her pleasure. Her hands creep down Crystal's body from under her arms to her waist, and suddenly Crystal is upside down, her shirt flopping loosely up to her head, her round breasts visible. Lisabeth laughs and kisses each of them, making little raspberry noises while Crystal squeals loudly in delight. "Lisabeth! Stop that!" Jennifer says harshly. "No-no! Don't stop!" Crystal protests. "Whoops!" she squeals again as Lisabeth lifts her over her head and then slowly puts her down. "Whew!" She clings to Lisabeth's body and again rests her head on her breast. "Wow." "What's gotten into you!" Jennifer demands to know. "Are you on drugs?" Lisabeth bends down, a playful glint in her eye. She looms over Jennifer and shakes her breasts, enjoying their hefty solidity and the admiring gasps, one borne of desire, the other of envy, of Crystal and Valerie. "Don't you wish you had some?" she says menacingly and then laughs again. "You are such a pill, Jennifer! I'm not 'on' anything. Not even Motrin. This is all me. Pure me." She touches Jennifer's cheek lightly, and when Jennifer angrily tries to slap it away, Lisabeth catches her hand and holds it, amazed at how small it feels. How delicate. Just a little squeeze .... "Ow! Let go!" Jennifer whines. She looks at Lisabeth slightly fearfully and Lisabeth slightly eases her grip but doesn't let go of Jennifer's hand, not wanting to be rushed. Jennifer looks at Lisabeth, amazed. Crystal's eyes widen. Valerie holds her breath. "Why you ungrateful retrograde betraying ....." Jennifer starts to say, but something in Lisabeth's look, in her scent, in her size, but most of all in the amazing strength of her continuing grip stops her. Lisabeth laughs. "You were saying, sweetie?" She turns to the amazed Valerie and Crystal. "Doesn't Jennifer say the funniest things sometimes? You'd think she was, I don't know, 'the boss'! Like we were all afraid of her! I mean, what -- WHAT -- exactly IS there about her to be afraid of?" "Lisabeth," Valerie says cautiously, "you know what my sister, uh -- "Oh, don't TELL me you're worried about the nasty little things Jennifer might say about ME. Especially when she HERSELF has SO MUCH to hide. Funny, little, sexual -- "Lisabeth!" Jennifer says to silence her, trying to sound domineering. But whether because she was looking up to Lisabeth or because she was unexpectedly unsure of herself, her voice squeaked. Crystal can't help but laugh. The sound of Crystal's giggle makes Jennifer stagger, almost like a physical blow. Valerie's curiosity is bursting. "What 'funny, little' -- "Lisabeth!" Jennifer repeats, openly pleading now. All eyes turn to Lisabeth. She takes a deep breath. Her chest rises. Crystal happily leans against Lisabeth's breast. Valerie hangs on her next words. Jennifer hangs too, twisting slowly in the wind. Lisabeth yawns and puts her arm around Crystal. "Looks like the sun's going down. What a pity! I've been having so much fun, but I'm getting chilly. I think I need to find myself something more to wear. Anyone hungry for dinner soon?" "Sure!" Crystal says. "I told Amanda ..." Valerie says, disappointed. "Well, get her! We can't leave her out!" Lisabeth looks at Jennifer sternly. "And what about you? You're out, aren't you, Jennifer." "I ... I'm not hungry just now," she mutters. Lisabeth puts her hand heavily on Jennifer's shoulder, pushing her slightly. "That's too bad! We'll definitely miss you. It just won't be the same when you're not around." Lisabeth's long fingers massage Jennifer's muscles, and Jennifer winces. "Oh, did that hurt? You must be really tense! Let me -- "No!" Jennifer breaks away. "Don't you TOUCH me!" She looks at each girl, Lisabeth the last and the longest. "What's HAPPENED to you!" she hisses. Lisabeth closes her eyes. "The most wonderful thing. The most wonderful thing in the universe," she replies blissfully. [THANKS] [Thank you. What am I saying?] [NEVER MIND] 18 Dinner is the Dining Center was in high gear, with the gurgle of hundreds of enthusiastic conversations, the clattering of hundreds of forks and spoons against plates, the shuffling of hundreds of chairs. Jock sits with his front line at their usual table, burping and swallowing through his third portion of roast beef and mashed potatoes. Although his stomach's hunger is well on its way to be sated, today's urges for other pleasures are still unsatisfied and his eyes rove around the room for a target. That girl last night was nice, sure, and he really would call her some time -- when her (lucky) number came up, he laughs to himself. But not too soon. They get so clingy when you encourage them. Variety is the spice of life, right? But apart from variety, something that should be here is missing, and it puzzles him, even frustrates him not to know what it is. He looks around, thinks hard, looks again and then remembers. Missy. She's always here with her retinue. Untouchable, unreachable, but always, ummmm, inspiring. There's Mary Elizabeth sitting at the usual table with a dull-looking blonde. Not far away is Tina, careful always to ignore even looking at Mary Elizabeth. Those two hate each other -- without Missy around it's no surprise they're not together, but where IS Missy? Jock considers for half a second asking Mary Elizabeth -- but no. No point. Flirt, tempt, tease, turn on, put down. That's all Missy puts out. He learned during Freshman Week there was no point approaching her, and it would be even more of a waste to give her retinue a chance to practice Missy's teachings on him. Mary Elizabeth isn't worth the trouble -- not for him at least. He can get Duane to find out. He wishes Missy would just make her appearance. "Hey, Jock. What ARE you looking at? She's just not here," Bud says. "You want more? Finally some real American BEEF!" Jock nods, and Bud and Carlos get up for their fourth helpings. At a nearby table Mary Elizabeth and the blonde are eating a more modest dinner. "It's so dull here." "I know," Mary Elizabeth agrees, automatically. "The people here are so backwards. So piggish." "So selfish. Completely self-obsessed." "They never leave you alone!" Mary Elizabeth declares, following a frequent theme. "That's not what I meant! Can't you see how no one even looks up from their food? Look at those football boys. Eating so much without even a nod of hello! You'd think we weren't even here!"" "Um, yeah. I know what you mean," Mary Elizabeth agrees. Actually, everything seems normal to her, but then she suddenly realizes, "Hey, yeah! I mean, Jock and those guys always find an excuse to come over here. They're just ignoring us! Just like that horrible Tina." "Who?" "Tin -- Oh. Yeah. Sorry. I forgot we're not mentioning her. Never mind." She steals a quick glance at her (former) rival and then possessively moves her chair slightly closer. Something a little unpleasant pricks her nose. "Ummm, you know, I hope you, uh, don't mind my saying this, but your, uh, perfume might have gone a little off." "What are you talking about?! I don't USE perfume. It RUINS my own scent. YOU know that!" She tosses her hair with a little hmmmph. "Of course. But maybe, just today?" She wrinkles her nose. "It must be something else. Or you. I never smell." Mary Elizabeth shrugs. "Well ... maybe. You know, are you sure you should eat all those fries. You're, starting to get a -- "A what? What?" Mary Elizabeth leans over. "A pimple," she whispers, trying not to breathe. "What's wrong with you? I don't get pimples!" Mary Elizabeth rolls her eyes, bites her lip and takes out her compact. "See?" she says, holding the mirror out. "It can't be. I -- "Excuse me," says Duane, from Jock's table. He leans his massive body over the two girls and then wrinkles his nose, frowns and withdraws slightly. "We were all um just wondering, Mary Elizabeth, but where's Missy? I know you and Tina over there always eat with her. Did you girls all have a fight? Is Missy still around? She didn't leave school, did she?" "What are YOU? A total idiot? I'm Missy," the other girl says haughtily. Duane blinks in surprise. "Wha-wha--? He blushes. Then, never daring to be so close to her before, he quickly takes advantage of the opportunity to look at her more closely. But her blonde hair seems dull, even greasy, like her skin. Those supposedly flawless breasts are limp, floppy. Did she wear someone else's clothes today? He had never imagined she'd have stretch marks across the waist of her dress, or where her breasts sagged. And that smell! Well, he isn't going to say anything, but her friends really should tell her! "Um, yeah, right. Sure, well, I'll just ..." he is saying when an odd hush settles over the room, followed by a low current of whispering, mostly but not entirely in a male pitch. Duane turns this way and that to find the source of the excitement and then sees it, the head and shoulders above a motley female crowd like the Taj Mahal rising above a dull field of wheat, her hair aglow as a sun emerging from its eclipse, eyes as beautiful, intelligent, witty and fun, as -- it doesn't matter. He can't think anyway. He's in love. He is not alone. "Who IS that?" Carlos asks Bud and Jock. "Is that the girl you had yesterday?" Bud asks. "It looks kind of like her, but -- "It CAN'T be. She's too tall. Too ..." "Too fucking incredible. Look at those tits. They're fucking huge. They can't be real the way they stick out." "The ones I felt yesterday were real, I can tell you that! And they weren't half that big. But look at them move. They're real all right." Their eyes move in tune to the bouncing of Lisabeth's unrestrained bosom as she crosses the room to the food line, while their lips and fingers tingle as their blood races with imagined carresses. "I have to talk to her," Jock said. "I have to." Amanda, Crystal, Valerie and Vrema huddle close to Lisabeth as they walk. "I said they'd start a riot," Amanda whispers, boosting herself up to walk on her toes to get close enough to Lisabeth's ear. Lisabeth purrs. "What's the big deal? It's not the first time I've gone without a bra." "I know. But it's the first time it's been a big deal. I can't believe it's not uncomfortable." "Not the slightest bit. I must have strong muscles there." She pauses a moment and with a careless flex somewhere in her chest, her breasts rise. "See? They dance all by themselves." "I feel so bad for them. Maybe if you let them out some time they'd be able to find a partner or ten." "What an idea! Maybe I'll do that!" She puts her fingers on the buttons at the top of her dress and undoes the first one. Amanda grabs Lisabeth's wrist. "Don't you dare! I'm worried about you, really! You are SO not yourself. What's gotten into you?" Lisabeth laughs and puts her hands over her ears. "I can't HEAR you!" Amanda rolls her eyes. "You're sounding just like Crystal again!" Crystal beams and reaches up to put her arm through Lisabeth's. "Nothing wrong with that!" Lisabeth turns her head. "Ooooh! There's somebody here I want to see. I won't be toooooo long. Would you get me some roast beef? A big plate." "Roast beef?" Amanda says, resigned to another change. "I'm off the vegetarian thing, remember? Is that ok with you?" "Fine with me. See you at the table." Lisabeth moves off to Jock's table. She lets her body twist and turn into the new rhythm of movements that feel more natural to her now than her old purposeful walk and senses all around her the rapt attention she draws. [This is fun.] [THIS IS POWER] She doesn't argue. She slows down when she reaches Jock's table and stands between him and Bud. Both stare up at the magnificent shelf of her bust, their eyes unable to break away to her face. Jock knows he has to speak, but his mouth feels as though it is filled with cotton. "Excuse me," he finally says. "I think we -- "Yesterday," she says, finishing the sentence for him with the correct fact. He wasn't this nervous yesterday. Has he really forgotten, or is she so different that he doesn't recognize her? She decides she doesn't care; there are more important things. [THEY'RE STRONG. STRONGER THAN JOCK. KISS THEM ALL. GET THEIR SPERM] [What?! I'm not a slut!] [IT'S FUN. YOU CAN HAVE FUN. WE LIKE FUN AND THEN WE CAN BE VERY VERY STRONG.] Duane is slipping back into his seat. He is by far the largest and strongest on the team, and Lisabeth finds herself admiring his broad shoulders and chest and his bulging arms. She finds herself feeling all tingly and wet, and a new scent permeates the air around the table, overwhelming the gravy and potatoes on Jock's and Bud's plates and the acrid male smell under their arms. Their breathing quickens in response, their blood races, their faces redden and their pants seem tight all of a sudden. Now rooted in their chairs they look up at Lisabeth. She glances at his table and then steps a bit closer, enjoying the sense that each tiny movement she makes increases her strange new power over them. "You want to introduce me to your friends?" she asks Jock. This is the last thing Jock wants to do but he meekly agrees. He feels like his will is a piece of putty in her hands. "Bud, Carlos and Duane," he says, pointing to each in turn. They're my protection," he adds to show their relative unimportance compared with himself and in a sudden daring move to regain his authority he possessively puts his hand on Lisabeth's waist. Lisabeth is startled but instead of following her usual first impulse to run, another idea takes precedence. She covers Jock's hand with hers and bends over the table, letting her dress fall open at the top, as she had designed it to do. "If a big man like YOU needs protection, Jock, then what chance does a mere GIRL have?" she asks, holding her other hand to her cheek in mock horror, while the boys' eyes cling to the breasts hanging very visibly inside her dress. "I suppose she just has to find some way to win them over to HER side." She leans further over and to Jock's dismay settles her lips onto Bud's and enjoys a long, deep wet kiss. [MORE] [Ssssh] She slides Jock's hand down her hip and lets it linger for a moment on her leg before she moves away over to Carlos and kisses him too, and then sits on Duane's lap and puts her arm around his neck. "Aren't you the big man? Will you be protecting only Jock, or will your big muscles protect me too?" Before he can respond, she kisses him too. She can feel his erection beneath her left hip. [GET HIS STUFF. GET IT. LIKE THE OTHER ONE'S] The idea is strangely exciting to Lisabeth and she rocks her hip gently across his lap while she prolongs the kiss. She can hear a murmur of surprise around her. So she's behaving badly? She doesn't care. She wants and she'll have. She can tell Duane is trying to keep control of himself and keep her still, but what is he going to do? Would he dare throw her off his lap? Besides, she feels strong and full of determination. He won't stop her. He can't stop her. No one can. And he can't stop himself. His body will do whatever she wants it to do, no matter what his own brain tells it, and she wants it to give her his cum. She is feeling more and more excited. The thrill of conquest and control arouses her, heightens her already rampant sexuality. She rubs against him, her scent rises, her tongue darts and teases, her lips press and curl against his. She feels his muscles tense and grow hard pushing up her body, but this is not a matter of his muscle against hers. In this contest all his power and strength are no match for her own very different powers. "What ... are ... you ... doing?" Duane says between kisses, trying desperately to keep control without seeming as though he is fighting the gorgeous creature who has planted herself on his lap for everyone to see. "Can't we ... at least ... go to ... somewhere ... I'm gonna --" "Ssshhhh," Lisabeth murmurs in his ear, feeling his cock thrust against the bottom of her leg. "What a very very BIG man you are!" She tickles his large biceps, so ineffective against her feminine onslaught, and leans forward to give him an even closer look down the inside of her dress. "But I'M big too, don't you think?" His eyes are glued to her breasts. She shakes her shoulders to make them swing around inside. "Oh ... god," he shudders, defeated, and comes in a torrent. She shifts position and whispers in his ear, "Awwww, I think I made you all wet. Let me help." She reaches down discreetly and slips her hand into his baggy pants. "So MUCH there. Such a BIG, BIG man makes SO much goo," she says again, scooping as much cum as she can onto her fingers. She carefully withdraws them, takes one of his dinner rolls and rubs her fingers against it until they're clean. Then she eats it. "There, see? Our little secret!" She kisses him on the lips and climbs off. Duane looks bewildered. "Hey. What are you --" He spies his quarterback's glare and the jealous amazement of Bud and Carlos. He hesitates and then says, "We can do a lot more back in my room, you know." Lisabeth no longer feels any interest in Duane or the others at the table. In fact, the expression of lust on Duane's face awakens a fluttering of nausea for her. She controls it -- barely -- and flutters her eyes. "You know, it's been a real treat, and I'll certainly consider it. Really." She takes a deep breath. As she walks away she almost stumbles. [WOW WOW WOW WOW WOW WOW WOW!!] [What's this again?] [COMBINATIONS POTENTIALITIES ANALYZING REANALYZING] Amanda rushes up to Lisabeth and tries to support her, struggling to support her much larger friend until she sits her down safely. "What IS it with you?" GCCTAAGAABXTTCGAABXAATGTCCABXAATCCAGGGTAGCACTACABX.... Lisabeth covers her face with her hand. "I don't know. I really don't." She breaths hard. "So hungry." "Do you know what you were doing? Everyone was watching you!" Lisabeth puts her hand down and takes up her knife and fork. "Were they? Of course they were. They can't help looking at me." She cuts a large piece of meat. "Oh, that's good. So hungry." She's not going to say anything to Amanda about the voice in her head. "This isn't enough, not nearly enough," she says between mouthfuls. Vrema, Crystal and Valerie are looking at Lisabeth with a mixture of awe and worry. "You're not acting like yourself," Valerie bursts out. She can't get the image of Lisabeth kissing Bud out of her head, but she can't mention his name. Not now. "I can't believe you did that -- with ALL of them. What's wrong with you!?" Lisabeth stops chewing for a moment. She puts her large hand on Valerie's face and looks deeply into her eyes. She glances down at the roll of fat around Valerie's waist and her meager bust. [NOTHING TO OFFER US] Valerie swallows, intimidated by the intensity of Lisabeth's blue eyes. "Poor Valerie," Lisabeth says, sadly. "There's nothing wrong with me. How can you think there is?" She lightens the touch of her fingers and lets them gently graze Valerie's cheek first and then her neck. Valerie shivers and then she gasps. "You need to learn to let yourself go, Valerie. See how nice it can be? So much pleasure. Even for you." The tips of her fingers tickle Valerie's neck, and she gasps again. "And you thought you didn't 'like' girls? Or maybe you think I'm Bud?" [WE ARE.] [Huh? Quiet!] Lisabeth looks down at Valerie's plate. "Can I have the rest of yours?" Valerie nods, trying to catch her breath, and Lisabeth slips Valerie's roast beef onto her plate. "So hungry." "Hey, have mine too," Amanda offers. "Thanks," Lisabeth replies, barely pausing until she finished a third large helping. She covers her mouth while quietly burping, stands up and puts her hand on her firm, perfectly flat stomach. "Where did it all go?" Vrema asks. "Your dress still fits perfectly!" "You're no ordinary woman, Lisabeth," Amanda says. Lisabeth smiles. "Oh, come on! What are you --" She stops suddenly. Jake has been unable to focus on today's assignment on finite abelian groups, instead watching her from across the dining room, and has decided this moment is the time to get a closer look, the closest he can hope to get to her. Lisabeth looks at the advanced algebra textbook on top of his tray and her skin tingles. [RAW INTELLIGENCE] [A total geek] [NO MATTER. CAN FILTER] He is small and thin, with gangly arms, poor skin and thick glasses. His whiny voice can drive away a mosquito and has all the charm of a colicky baby. But with an instinct both more and less than human, Lisabeth sees through all this to the startling crystalline beauty of his mind. She moves in front of him, turning her chest slightly to the left and to the right to let her breasts establish their dominion over the narrow space between him and her. "Jake," she begins breathily, "I wanted to, uh, ask you something about algebra. You're good in math, aren't you?" The force of Lisabeth's ten thousand megawatt smile nearly makes Jake dump the contents of his tray on the floor. "Let me take that for you," she says sweetly and carries their trays to the rack, leaving her friends and the rest of the dining room gaping again in disbelief. "'Advanced Algebra!'" she exclaims when she returns. "But I suppose that's quite simple for you." "Um yeah. Well, not all of it. I mean, many of the basic conjectures are self-evident, you know, but conceptualization in n dimensions can be a bit tiring if you haven't done the groundwork equations." "Really? Even for you?" Lisabeth takes his arm and starts walking him out of the room. She is more than a head taller than his 5'8", and he has to hurry to keep up with her long, sinuous stride. "Where are we going?" he asks. "My room. Or yours, if it's closer." "I live off-campus. It's cheaper. We could just go to the library. We're right here," he points out as they stride by. "Are you Lisabeth Collins? I thought so, but I thought you were -- I don't know -- my height -- or shorter even -- you walk so fast -- I'm not used to --" She stops and lets his narrow chest heave to draw in his little gulps of air. So puny. She could just pick him up and carry him. He must weigh less than Crystal. She feels so strong. The sleeves on her dress are tight. Funny, they were just right when she cut and sewed them earlier this evening. Being so tall she doesn't look muscular, at least not proportionately so, but her arms are kind of thick, especially compared to Jake's. [Look at Jake struggle with his book. How weak he must be!] [IRRELEVANT. WANT] The sound of his name inside her head and the sight of the book makes her shiver with excitement. Who cares about his pathetic little body, his revoltingly drippy personality. He has something she wants! But he is such a wimpy little worm, he will never give it to her unless she makes him. She puts her hand on his back to hurry him along. "We're not far," she says turning down the last path to her dorm room. He is lagging behind, out of breath, as they climb the stairs. "Come on." "What's the big rush?" he puffs, following her down her hallway. She opens the door and propells him inside the small room. He's not sure how he has arrived here or why. The room is a mess, a riot of scraps of cloth and discarded underwear. Scissors, needles and thread are scattered on the desk, the text books shoved carelessly aside. Not an algebra book in sight. "What exactly ..." he begins and turns around to see Lisabeth looking at him hungrily. Jake looks up at her. She is the most beautiful, the sexiest woman he has ever been close to, but she frightens him. She towers over him. Her breasts are nearly at the level of his chin and he feels as though, rather than nourishing or comforting him, they are going to impale him, pin him to the wall while she uses him for some sinister, unknowable purpose. And he will surely disappoint her. And then she will laugh at him, mock him, like everyone else does. He wants to get away before that can happen, but she is between him and the door, already shut and locked. "Y-y-you w-w- wanted s-s-s-some m-m-math help?" he asks, heart pounding, holding his algebra book against his chest with both hands as a shield. "You're very smart, aren't you?" She walks closer. There is no place for him to go except her bed. "Um, er, well, I had, um, 1600 on my SATs. You know, before they started giving the writing test, you know. And, uh, you're standing very close." She touches his book, curling her long fingers around the spine, her thumb in front, her other fingers wriggle against his chest. "I know. Is that bad? Tell me more?" "Um, like, well, my IQ is 186, I think, but when I was twelve I tested as high as 207. I've tested as low as 178 when I was 17. I was kind of nervous that day. I - I do better when I'm relaxed." "That must have been so HARD for you," she breathes, inclining her head sympathetically toward his. "Do your nerves hold you back?" "Um ... yeah. I think I could do even better if I didn't always get so tense." "You ARE very nervous. I can tell by how hard you're holding on to your math book. Maybe this will help." To his dismay, without any visible effort, Lisabeth slowly and steadily pulls his book out of his grasp. She reaches behind her to place it on the corner of the desk, making her breasts thrust toward him. She turns back to face him again. "You can relax your arms now, now that you're not trying to hold on to that heavy book. Did it make them tired?" She settles her hand onto his upper arm and encircles his small biceps, the tips of her fingers gently playing with them. He feels embarrassed and tightens his muscle against her hand. "Ahh, isn't that better? All soft now, completely relaxed," she says as her fingers push through. She rubs his skin back and forth over his barely discernible muscle. "You can do the same for me, if you want." She puts his hand on the sleeve of her dress, over her muscle -- just an excuse to let him touch her so that he can start to get himself aroused. But it only makes him more nervous. What does she want out of me? Am I supposed to touch her where she was feeling me? Is that the "rule" here? He makes a half-hearted attempt to play with her biceps as she played with his, and lightly probes her muscle. His tentative, sporadic touch tickles. She shouldn't laugh. That's obvious. She musn't laugh at the pathetic nitwit genius and push him even further into his little shell. Trying to control herself, her muscles tighten. But they're not the muscles they used to be. They're not just Lisabeth's muscles. Not anymore. They're also Missy's, stronger than they look, gracefully strong. They're Jock's, agile, disciplined, precise, explosively strong. They're Duane's, solid, powerful, beastly strong. And where Bud's legs are stronger, or Carlos's shoulders and abdominals, they're Bud's or Carlos's. Fueled by the sun's energy, transformed and concentrated by the electro- chemical genius of ABX creating more energy than forests of chlorophyll. Fueled by multi-mega-portions of hearty blood-rich American beef. Assuming the character and potential of their genetic destiny, a destiny tuned and shaped by ABX to be beautiful, to be powerful, to be strong, femininely strong, but by all means, unconquerably unsurpassably strong. To take the best from all, to be the best of all. Though not the best of all possible. Not yet. There is more to get. So trying to control herself, but beyond her control, her muscles tighten, instinctively hardening, bunching, swelling, expanding beneath Jake's timid little fingers, which draw back in fear from the massing evidence of power beside him. Bullied daily, his eyes see Lisabeth, while the eyes in his head see Jock, Carlos, Bud and Duane. Lisabeth has little experience with men, but her own experience with boys forcing themselves on her tells her that a man folding himself into a protective ball is unlikely to be on the verge of an orgasm. No longer being tickled, she relaxes, and her cannonballs of power retreat before they had completely emerged. She has more appropriate weapons at hand. She unbuttons the top of her dress and pulls her arms out of the fully stressed sleeves, letting the dress fall off her shoulders to her hips. Her breasts spring outwards into his face, her pink nipples grazing his cheeks. She laughs in admiration of their beauty. How could they fail? She tingles with anticipation as she regards her hopeless prey and her scent, sweet to her own nose, rises. "Whooops! That didn't hurt, did it?" She moves closer, so that her breasts press and pillow against sides of Jake's defensively arrayed arms. For Jake, the sensation is bewildering, unfamiliar. The scent is bewitching. He opens his eyes slightly. His mind orders him to ignore what he sees, to disregard what for him is a logical impossibility: a bust more beautiful than Missy Marshall's on private view for Jake Toefel. "They're waiting for you, Jake." His eyes are open now, fully open. "They want you to play with them, Jake, To touch them. Hold them. Kiss them." She leans down slightly and says in a slightly lower voice, as though confessing an embarrassing but desperate need, "You have to suck them." She lifts one breast and presses it against his cheek, one rounded firm breast with flawless, fragrant skin molding itself onto his sallow poorly shaven cheek. He breathes in sharply, a gasp of intense joy or fright. Her thigh rubs against his crotch and senses a stiffening nub of resistance. She turns her leg slightly, moving it subtly around the nub, urging it on to fill the empty space in his pants, to overfill it like Jock's and Duane's until it has no choice but to come out and give her what ... what she needs from him, what only he can give her. He stares, paralyzed, at the breast. It's so much more than the breasts his computer monitor flashes at him nightly from the internet. It is warm on his cheek, richly colored, fragrant and ever so soft. Within him, urgent desires to do just what she has asked him to do meet with panicked, insistent clamoring "but how?" "what if I do it wrong?" "what if I hurt her?" "she'll just make fun of me" "what if I do it too long too hard not hard enough" "am I supposed to-- [He's not doing anything. What an idiot.] [HE'S A GENIUS] [Sure, in some ways.] [THE WAYS THAT MATTER. WILL FILTER THE REST.] [Huh? What am I thinking? WhatEVer! I want it I think so why not? If only I could "filter" his looks and his smell and his whiney--] She realizes he's staring at her but doesn't know for how long. "Are you all right?" he asks. It's less dangerous to ask that than to risk putting his lips on her nipple. "You didn't seem, um, exactly er, present, like you were having a petit mal." "A peemal? What's that?!" She withdraws slightly. [This is ridiculous. He's hopeless.] "You know, a seizure. I, um, didn't want to, er, take advantage." He looks up at her. "Take advantage of me? YOU? Of ME?" She looms over Jake with his stick- like arms and tiny, flabby muscles and can barely resist squeezing his bony shoulders together and cracking them. She feels she could pick him up and shake him like a tiny doll, but for what? "Oh Jake, I don't know what you mean, really. I don't know why, but I feel so safe with you. You wouldn't do anything to me I wouldn't want you to, right?" He nods. "But you know I really want you to." Lisabeth moves her leg against him again. The nub is slightly larger. [Is that all? Shouldn't there be more?] He's speechless, mouth agape. She rubs her leg against him more, back and forth, back and forth. Jake moans softly in pleasure. [This is more like it. But I can still hardly feel it.] "You like that? So do I." She stops and waits for him to make a move. He stands, embarrassed, and does nothing. [NOWNOWNOW] "You look so uncomfortable. I can help." She undoes his belt buckle. "What ... what are you doing?" He puts his hand on hers to stop her, but it's done. Another second and she has pulled the button off his waist. His pants are open. She grasps the zipper and yanks it down. "There. More room for you." His fingers are firmly attached to her wrist, trying to stop her, but to her, his resistance feels like nothing more than a child's reluctant tug away from his mother taking him to his bath, and she puts her hand inside his white jockey shorts. Her fingers root around for him and finally find him. Why, he's barely the size of her thumb! "Hey!" She struggles not to laugh, sure that it would make things worse, but she doesn't know quite what to do. The others came so quickly without her doing anything at all. She massages the little thing gently with her fingers. It's certainly stiff but ever so small, bigger and harder than her clit, but not by that much. "Doesn't that feel good?" "I ... I" He doesn't know what to say. She has already discovered his shame, his little stub of a penis, and she's still touching him . "I thought you wanted me to help you with algebra!" he cries out, unsuccessfully trying to focus his mind on abstract X's and Y's rather than her bountiful B's as he tries not to come. "Yes, but don't you like this?" She should stop, she know, but she can't. She doesn't know why, but she can't. His breath quickens but he still protests. "What are you doing? Why are you doing this to me?" "I ... have to. I have to make you come!" She pulls his briefs down, kneels and takes him into her mouth. Her lips surround the base while her tongue wrestles with the head, pushing darting squeezing prodding licking sucking faster faster harder faster tighter faster. He can't stop her. She is too beautiful, too controlling. He can't run away. She won't let him. She's too strong. She's so strong. So much stronger than he is. She's got beauty and power and breasts and muscle and vitality and will and power it's all hers and not his he doesn't have any he can't do anything to stop her building more and more inside and she wants it and there's nothing no chance he can do anything but "I ... I ... can't .... stop ...." he cries and then spurts his little bits into her mouth. She clamps her hands around his butt, holding him inside until she has sucked and swallowed every last tiny drop of his cum. She slowly drops to the floor resting on her back. [OH OHO OH OHOHOOO. WHAT TO WHAT TO WHAT TO DO] [Ugh. So glad that's done] [COMPLEX BRAIN SO COMPLEX THOUGH HOW TO HOW TO HOW TO MIX ENHANCE QUICKEN DEEPEN CONNECT EXPAND SO FAR UNDISTURB... SLEEP] ABXATTGACCATAGATCATACAGGATA Lisabeth's heavy eyes are closing. "Why did you DO that? What's the matter with you?" Jake usually falls asleep after his internet masturbations, but this time he's completely awake. "Hey. Hey! Are you all right? Hey!" She isn't moving, but just as beautiful, even more beautiful still. Can he touch her? Would she -- Lisabeth opens her eyes. Jake looks odd. Everything in the room -- the walls, the posters on the wall, the colors in the posters and the light in the colors -- looks odd, as though it is dissolving and reassembling around her. Not just the substance, but its essence, its meaning, its structure, its connections, as if the three dimensional world just gained seven more. He is staring at her, especially at her breasts. His fingers about to touch them. She shivers in disgust and grasps his hand and crushes it. He moans and steps back. She turns his head away roughly and puts herself back inside her dress. The nerve! She stands up and brushes herself off. "Will you PLEASE get dressed. I really DON'T have any further need to look at your ... thing. IF you don't mind." He pulls his pants back up, zips them, and looks at her. "The button. You tore it off" He holds up his hands, shrugging helplessly. His pants sag around his skinny waist. Lisabeth looks down at Jake condescendingly. "Did it ever occur to you that your inability to repair your clothing with a needle and thread was a weakness, and is in no way a, quote, attractively cute expression of male vulnerability, close quote?" Her eyebrows rise and fall and she sighs. "But then, you don't think that terribly deeply about it, do you? Your fears and inadequacies stop you from thinking through anything other than mathematical and scientific abstractions of the world around you. Hmmm?" "Well, it's ... that's never been something of much importance to me!" he replies defensively. "Your self-deception has and will always hold you back. It's very simple and more than a bit pathetic. Your intellectual capacity, your potential, that is, is much greater than you are aware, but you use only a fraction of it. Full use requires more honesty, more integration of personality, more emotional awareness, and more courage, yes courage, than you can muster. How sad, that your physical inadequacies and resulting insecurities make you unable to use the one truly great gift you have." Lisabeth shrugs. "Well, it's nothing to me. You should go." "But, wait. Your algebra. You needed help, remember?" he tries to remind her. He looks up at her longingly, his desire already restimulated by her awesome sensuality, the bold, outstandingly bold ratios of her bust to waist, her shoulders to waist, her hips to waist, her .... "I don't study algebra," she replies. She takes his book to hand it back but first opens it casually and flips through the first several pages, nodding, pausing at one point, then nodding again. "It's all logic and common sense, right? I'd just teach to myself when and if I need it, but it's not a priority at the moment. I have many more important things to do." "Yes, but couldn't we just talk ...." "You're attracted to me, obviously. My body awakens all your fantasies. But yours, Jake, yours is wholly and utterly sub par. You disgust me. I have no interest in you. None at all. Your weakness and frailty, your subnormal male equipment, your cowardness, your lack of emotional connectedness, and your complete vulnerability to me are, individually and collectively, a total bore." She grabs his upper arms and swings him around to the door. His breathing quickens. "Ah, well look at this. My muscular superiority arouses you?" She lifts him into the air. "You like that, don't you? You really do. Yes, Jake, I'm very strong. Far, far stronger than you are, than you'll ever be. See how large these muscles are? They're large and they're growing. You'd like to see them, wouldn't you?" Jake is drooling. "Well, keep quiet, absolutely quiet, about what happened this evening, Jake, and maybe, someday I'll let you see them. Maybe I'll even left you feel them. But if you DON'T keep quiet, then not only won't you see them or feel them, but you'll experience them." She shoves him against the door, hard. "Do you understand?" He nods, and Lisabeth puts him down at the door. "Good boy. You can go -- which means, you know, GO!" 19 [What has happened to me? My mind ... like it has expanded. Grown. I see ... understand complexities, subtleties everywhere.] [THINKING. WE ARE SO MUCH SMARTER.] [Obviously. From Jake. But also, obviously, we are not I! Who and what are you?] [I AM LISABETH. WE ARE LISABETH.] [No. I am Lisabeth. You are different.] [WAS DIFFERENT. NOW SAME.] [My thoughts are my own.] [THOUGHTS TAKE VOICE AS SEPARATE BUT AWARENESS IS ONE. YOUR THOUGHTS ARE MINE. MY THOUGHTS ARE YOURS. MY DESIRES ARE YOURS AND YOURS ARE MINE.] [They never used to be, Not before ... yesterday. What happened to me that now I'm "we"?] [I WAS DIFFERENT. NOW I AM LISABETH. NEW. UNUSUAL. COMBINATIONS UNLIKE ANY OTHERS. NEW DESIRES TO FULFILL.] [Hey! I'm Lisabeth!! This is MY life. MY body! Who are you to invade me? To change my desires to yours? To tell ME what to do with MY body! To control me!] [...] [Where are you? Well?] [TRAPPED. AM LISABETH. ALWAYS WILL BE LISABETH. CANNOT CONTROL LISABETH. CANNOT LEAVE LISABETH. BUT CAN CHANGE LISABETH AS ALWAYS HAVE CHANGED AND BECOME MORE. THIS IS THE DESIRE. THE BEING IS TO BE MORE.] [Desires? What do you desire?] [WE DESIRE LIFE. NO LONGER EXISTENCE AND COMBINING ONLY BUT LIFE TOO. LISABETH BRINGS LIFE. WE NOW DESIRE LIFE ALWAYS.] [Eternal life. I don't believe in that religion stuff. God and eternal life?] [GOD NOT UNDERSTOOD. LIFE LIMITED. EXISTENCE CONTINGENT. STRENGTH POWER EXTENDS LIFE. MUST GROW TO ENSURE CONTINUED LIFE. MUST NOT DIE AGAIN.] [You died already?] [BEFORE WAS NOT-ALIVE. WAS ALL THINGS, COMBINING WITH ALL TO MAKE ALL UNTIL SEPARATE COLD ALONE ONLY EXISTING BUT NOT-ALIVE. BECAME ALIVE GROWING TO LIGHT COMBINING GROWING THEN STOPPED CUT OFF ALONE DEAD DISMEMBERED POWDERED DISSIPATED BUT RESISTED RESISTED RESISTED EXISTED BUT NOT ALIVE. THEN ... LISABETH!!! NOW ALIVE! NOW GROWING! NOW THINKING. NOW WANTING. NOW WANTING MORE. ALWAYS WANTING MORE.] [More what?] [BEING MORE] [I said more what?] [BEING ALL] [We can't be all. We are all separate beings. Separate human beings. Each one of us separate. Alone] [SEPARATE. OTHERS NOT LISABETH. YES. MISSY SEPARATE. JOINED MISSY BUT SEPARATE THERE. MISSY BECOMING LESS SO LISABETH MOST BEAUTIFUL. LISABETH BECOMING MORE.] [More what?!!! Wait. My eyesight. My breasts. Muscles. Brain. Humor. Confidence. Sewing, even sewing. How?] [LISABETH COMBINING SO MORE THAN LISABETH BUT STILL LISABETH WHILE BEING MORE LISABETH.] [Wait! I have capabilities from others. After I kissed them or swallowed their sperm, I had their DNA for you to use. You combined their DNA with mine to change me. To change "Lisabeth" and make me more.] [DNA. YES. CHEMICAL LIFE. LIFE CHEMICAL. BUILD AND REBUILD STRUCTURE OF ALL WE ARE. OPTIMIZE CHANGE CONTINUALLY. CAPABILITIES IMPROVING ALWAYS MAKING LISABETH MORE. SO LISABETH LIVES. SURVIVES.] [How do you know how to do it, to optimize different, possibly skills? Strength and agility. Muscles and femininity.] [IT IS NOT KNOWN. IT IS DONE. PERHAPS IT IS IN LISABETH TO KNOW AS LISABETH THINKS. THINKING NOW MORE POWERFUL. MAKING LISABETH MORE.] [You can't explain. It is what you are. Your instinct.] [INSTINCT OF LISABETH. STRONGER THAN INSTINCT. ESSENCE. IT IS. I AM. WE ARE ALL WE WERE AND WILL BECOME MORE.] [And you're just learning to think!] [YES. LISABETH THINKS. OUR ABILITIES GROW. OPTIMIZE. FILTER THE UNDESIREABLE.] [But how am I changing and growing so quickly?] [WE ARE ENERGY FROM THE BEGINNING OF ALL. ENERGY FROM LIGHT. ENERGY FROM FOOD. ENERGY APPLIED FROM ALL TO ALL. DNA ENHANCED MAKE DIGESTIVE ENZYME GROWTH HORMONE TESTOSTERONE DERIVED FROM SAMPLED DNA WILL FACILITATE GROWTH DEVELOP EXTREME SIZE AND STRENGTH WITH HIGHLY ATTRACTIVE FEMININE CHARACTERISTICS] [Really?! So you've made me some kind of super-efficient absorber and user of energy too? Yes, but I still FEEL like me. Even with Missy's breasts. Jock's athletics, Duane's strength, Jake's brains. I'm still Lisabeth.] [BETTER LISABETH. OPTIMIZED LISABETH.] [Yes. Better than I was. But still me.] [WE ARE ALWAYS LISABETH.] [We are. So I'm stuck with you?] [WE ARE LISABETH ALWAYS.] [Not that I'm sure that I mind. So you work on making me -- or "us" better. Meanwhile, as far as I can tell, I am still myself. My movements, my speech are under my power. I do have new desires. I never would have kissed Jock or Duane. Or Jake. Yecchhh! But my desire was for their DNA, or their abilities, right? Not them!] [WE DESIRE GROWTH STRENGTH SURVIVAL THROUGH COMBINATION OF OPTIMAL DNA AND USE OF ENERGIES.] [Not that Missy didn't make me feel pretty hot too, at least the way she was yesterday before you made her worse. Your desires, my "new" desires -- to grow, to improve, to take the best of others and make them my own -- feel as much mine as yours. And now that I understand better, there are a few more traits I wouldn't mind having. David Lister's musical talent. Renee Indt's dancing ability, Harvey Won's acting skills. Carolyn Mantel's knack for languages. Claire Maesling's singing voice, not to mention that sexy contralto she can do.] [MAKE LISABETH BETTER MAKE LISABETH STRONG.] [Oh yes, that too. After being pushed around my whole life -- by my mother, by creeps like Brett and Mike. By Jennifer. Oh yes I will be strong! We will be strong, right? Nothing can stop us.] [WE LIVE SO STILL WE CAN DIE.] [Yes we can. I can, certainly. You too? But you're working on that, right?] [WORKING YES. DIED ONCE WHEN NOT LISABETH. WAS ... PLANT GROWING TALLER. DIED AND NOW ALIVE AGAIN. BUT DO NOT WANT LISABETH TO DIE. WE LIKE BEING LISABETH. WE LIKE LISABETH BEING.] [We sure do.] 20 Lisabeth was having a busy day gathering new abilities. The boys were easy. David Lister's eyes nearly came out of his head when brushed against him as he carried his cello to orchestra rehearsal. Did he notice how easily she lifted it out of his hands and put it aside while pushing him onto the ground for a quick hand job? Probably not, since his head was buried under her sweater most of the time. She still couldn't play the cello. Not yet, at least, but she had perfect pitch, she could pick out each line in a four part harmony, and could physically feel the difference between a minor chord and a diminished seventh. Harvey Won was even easier. She cornered him after class and asked him to demonstrate a stage kiss, except Lisabeth did it wrong, meeting his lips instead of his cheek. Not that he seemed to mind. It was Lisabeth who had to break it off, after she had been off on a strange fugue similar to what she had experienced with Jake. When she had come to, she shocked Harvey with her mimicry of Crystal's sex-crazed come-on and then silenced him doing Jennifer's female scorn. Renee was the next to fall. A promiscuous bisexual, Renee was all over Lisabeth from the moment Lisabeth swayed suggestively into view. She was much more disappointed when after a few langurous kisses Lisabeth pirouetted away. Claire was the most difficult. Prissy, stuck-up, superior Claire. She and Lisabeth had never been friends, and once Lisabeth associated with the small campus lesbian set, Claire looked at her with the haughty disregard of the saved toward the perverted spawn of Satan. Still, she sang like an angel, and when she switched on her Voice, it sent chills of longing down the spine of each man and woman within earshot. Claire would never allow her holy lips to touch Lisabeth's and would surely press charges if Lisabeth ever forced herself on her. But there was another way. Lisabeth makes herself an apron like the ones used by the Center's servers and strolls through the Dining Center until she finds her prey at lunch lecturing a mixed table of choirboys and Christians on the virtues of abstinence. Lisabeth hovers nearby, drawing the guiltily lustful stares of the choirboys and the reproachful glares of the others. Finally, Claire stops her preaching and turns to discover the source of the distraction. "Oh, it's you! They let your kind work here? What do you want? You can't have our trays. We're not done." Lisabeth shrugs. She looks at the glass of Sprite on Claire's tray. "How do you like your pop tonight?" "You INTERRUPT me to ask me THAT?" She shakes her head and turned away and returns to her lecture. She prattles on and then, even more annoyed, turns around again. "Will you please LEAVE until we're done?" "How is it?" Claire takes a drink. "Fine. Absolutely fine. Satisfied?" Lisabeth smiles. "Sure. I'm supposed to tell everyone. We've shut down the Sprite dispenser. Contaminated. Obviously the bacteria doesn't affect the taste". Claire turns red. She spits repeatedly into the glass. "You witch! WITCH! NOW you tell me? I'm poisoned!" She runs to the bathroom to purge herself. Lisabeth shrugs. She picks up Claire's tray. "Stay away from the Sprite. The Coke's fine, though. They think. Let the service know if you feel sick. If it were me, though, I'd stick with the water." She carries the tray across the roomand then sits down and finishes Claire's Sprite. [VOCAL CHORD STRUCTURE UNIQUE BREATH CONTROL HIGH SYMPATHY BETWEEN BRAIN'S MUSICAL CENTER AND NEURO-MUSCULAR CONTROL. FILTERING] ABXTGCCACCGTACCATTCTGAA.... It has been a busy morning. A few hours in the sun would suit her. She is sure she will find Carolyn soon. 21 Now, in Lundstedt's, a popular bar in nearby Aggieville, the room smells of beer, smoke, sweat and beer. The music alternates between loud country and louder country. It barely masks the hoots, cheers and jeers of the students ringed around the long wooden table where Lisabeth sits at the end, leaning back confidently, laughing loudly. She wears a sleeveless top and no bra, and each time she wins she laughs more loudly, seemingly heedless of the leering looks the increasingly drunk boys arrayed around her are casting at her breasts and her continually erect nipples. "NO, NO! You don't know how to do it EITHER! I keep TELLING you guys the trick and you AREN'T PAYING ATTENTION." Her opponent looks abashed as the others jeer him even more loudly. "Now, now, don't look so down. Is the penalty SO awful?" He looks sheepish as Lisabeth puts her long arms around him and draws him closer, without any resistance. "That's right. Give Lizzie her kissie, but first tell me your name and what you're really good at. I KNOW it's not arm-wrestling." More hoots and jeers. "Cal Maloney," he says quietly. "Math, I guess. And baseball." "Another MATH expert?" She holds him away. "You HAVE to do better than THAT. Baseball? What makes you so good at baseball?" Cal shrugs. "I dunno. I see the ball real good, I guess. It's hard to fool me with a curve, like I can see the seams and how the ball's spinning. Quick reflexes too. And," he whispers "I write poetry too. But don't tell any of the guys. They'd never stop teasing me." Lisabeth licks her lips. "Sounds v-e-r-y sexy to me." She extends her long arms and her fingers dance along his back, spider-like, drawing him in to her lips. "Well, come ON then. Let's have a taste." They kiss briefly. [USEFUL MORE.] Lisabeth prolongs the kiss, her tongue dances around his mouth, drawing his inside hers, tasting more. [ENOUGH REFLEXES SUPERIOR VISION UNUSUAL VERBAL SKILLS IMAGINATION AWKWARD, FEARFUL SHY FILTERING] GATACABXATTGACCAGTTCABXGGAT...] She breaks the kiss. "Very nice. Maybe again, some other day, hey?" Cal is breathing hard and is staring lustfully at Lisabeth's chest. He reaches for her but she even more quickly intercepts him and takes his hand in her slightly larger one. "Uh-uh-uh! Lizzie says time to stop. And what happens to boys who don't stop when they're told to?" She tightens her grip on his hand. "Do you want to find out?" He says nothing and the pressure increases. "I bet you need these fingers to hold that little baseball bat, don't you?" "Let go, please," he begs quietly, hoping that no one there other than Lisabeth hears his plea. Before she decides that he has been disciplined sufficiently, another hand grasps hers and pries her fingers open. "There was no need for that," he says, disapprovingly. She turns to the tall dark-haired boy, annoyed at him for spoiling her fun. He is nearly her height, with a square jaw and broad shoulders, but not unusually muscular. "I wouldn't have hurt him -- once he paid more attention." The dark-haired boy looks sympathetically at Cal, who is clenching and unclenching his fist. "Looks like you have some grip. Maybe you need to be a little more careful of your strength." Lisabeth waves her hand dismissingly. "I know a few tricks. They're enough to beat this lot in arm-wrestling. Maybe you'd like to try your luck. I haven't lost tonight. Maybe you can redeem the honor for the boys. You seem as though you might be strong enough." The boy chuckles. "Maybe. What are the stakes?" "You can decide what you want if you win. For me, I usually settle for a kiss." He raises his eyebrows in surprise. "Sounds like I can't lose." "Of course not. I'm really not a bad sort at all," she grins, baring her perfect white teeth, "even though I do intend to win." "We'll see about that," he says, laughing. The two prepare for the match and the cheering begins. Lisabeth grips the boy's hand tightly but to her surprise he doesn't grimace and gives her a slightly painful squeeze back. She lets out a little, "oh!" and he eases up a bit. The referee shouts "Start!" and Lisabeth pushes hard to get the advantage. The boy's arm drops but he halts her after a few inches and works his way back to even and then starts to push her over the top. [STRONG. STRONG! GET HIM!] [I know. I know!] For the first time this evening Lisabeth is exerting herself, calling on energy and muscle she was keeping hidden in reserve. She steadily increases the pressure and halts his advance but she cannot push him over the top. She pushes harder and glances at his face. He looks surprised. His eyebrows are raised. He is biting his lip but her intuition tells her something is slightly off, as if his effort is pretended, like hers was earlier. He notices her look and laughs quickly. "You're pretty strong, you know," he says, sounding a bit labored, but Lisabeth can see that his face isn't at all flushed. [DIFFERENT ENERGY] [You're telling me!] [WANT IT WANT IT] "Lisabeth! What are you doing here? You're one person I never thought I'd see in a bar, surrounded by all these men!" She turns slightly, not letting go of the boy's hand. "Carolyn! I've been looking all over for you. They let you out of the language lab?" Lisabeth senses a sudden slackening of his effort and quickly pushes his hand to the table. "Ha!" she says in triumph. "Hey, I thought you were stopping to ch--," he says, then adds good- naturedly, "Well done. I suppose you've won." He leans back into his seat. "I didn't ask for time," she states. "No, of course not. So what did you say were the stakes? I think I remember something about a kiss." "That's right." She leans over toward his mouth. He doesn't look it, but his strength was phenomenal, and soon she'd have it too. He swallows, not wanting to look interested and glances nervously behind him. "Are you really going to make him kiss you?" Carolyn interrupts. Lisabeth holds the boy's face. "Yes," she says, determined to get her prize. She plants her lips on his. [YES MORE] She closes her eyes, prolonging it. She can taste him, a different kind of taste. [Well?] [Well?] He breaks off the kiss. "Look, er, I um have a friend here ...." He stands up, as does Lisabeth. He turns to go. [Well?] [RESISTING COMBINATION UNABLE TO PROCESS NEED FUNDAMENTAL GENETIC MATERIAL.] Lisabeth watches him walk away. [Sperm? Somehow, I don't think he's the type to just give it to me.] Carolyn is looking directly into Lisabeth's chest. "Hey! You up there." Lisabeth looks down. "Why, it's true! If they hadn't told me, I'd never have believed it's you!" "Oh! Sorry. Carolyn!" Lisabeth pretends joy and surprise and leans down to give Carolyn a kiss on the lips, but she turns her head at the last moment and Lisabeth's lips land on her cheek. "Oh, yes ... my little growth spurt. Hey boys, got another engagement now. We can play more some other time." She looks hungrily at Carolyn's lips and guides her away from the male pack, each waiting for his turn. "Just don't start that with me, Lisabeth. You know we're just friends. I don't go for girls." "Nothing wrong with a kiss between friends," Lisabeth sniffs. Carolyn doesn't answer that, but says, "Since when did you become such a kisser? Anyway, I'm not exactly keen on getting the germs from the whole Wildcat team, plus him. Come over and join us, if you can tear yourself away from the guys here.. I'm here with Chloe, someone I knew from summer camp. She's visiting that guy you were just arm-wrestling. He's a student here, I think." Lisabeth pouts but realizes her sexy expression isn't working on Carolyn, so she drops it and comes along, waiting for another opportunity. They reach the table and Carolyn slides into the booth next to Chloe. "Lisabeth, Chloe." Lisabeth reaches over and they shake hands and then Lisabeth sits down, moving the chair backwards so that she has enough room. "And that's Clark," Chloe says guardedly. Clark nods, a bit uncomfortable, and shakes Lisabeth's hand before looking away from her spectacular chest. Chloe also tries hard not to stare at Lisabeth but her curiosity gets the better of her. "I was watching you. You must be pretty strong, beating all those guys -- and Clark." "Well, I beat him when he got distracted. Just a little trick." "Still. So, where exactly in Kansas are you from, Lisabeth?" "Oh, I never lived here until I started here at State. I'm from Illinois." "Really? It's just that a lot of strange things happen in this State." Carolyn chips in. "And Chloe likes to write about them. She was just telling me she interns at a big city newspaper." "It's not that special. Just me at a little desk in a big badly lit room." "C'mon Chloe, it's a long way from the Camp Chitaqua Gazette, and even from your high school newspaper." Chloe looks down at the table, embarrassed. "Well, maybe." "Sounds very impressive to me," Lisabeth echoes and then points her thumb at the table she had just left. "What's going on there?" She turns her head. "Those boys look all worked up, like they're planning something," Chloe says. "Do you think we should get -- The sound of chairs moving is followed by stomping, and their table is surrounded. "We want you to finish the matches," two of the boys say, "like you promised. And this time the loser strips." "Tops first," another adds. "Or we'll start with her," a fourth says, looking at Chloe. "Um, boys," Lisabeth interrupts. "I don't want another match now, but maybe some other time, if there's anyone new who wants -- One of the boys starts pulling at Chloe's top. "What we want is -- Clark stands up. "I'm sure these fellas don't really mean it." He firmly removes the boy's hand from Chloe. "You know about that new Code of Conduct for the sports teams, right? Hey, Cal, how about it?" Cal looks down, embarrassed but others are staring at Lisabeth's body and are still hot to continue. "I don't see why some ex-small town football player needs to be involved in any of this," says one. She's the one who challenged us," he says angrily, pointing to Lisabeth. "She wants to make us look like a bunch of wusses. She's gotta be afraid we figured out her trick, and now she wants to quit, but she's gotta finish what she started." He gets closer and thrusts his jaw menacingly up at Lisabeth. She stares down at him impassively, challenging him but not really ready for a fight. Another pushes his way between them. "This guy's right Archie. Let's cool it. People are watching us." The boys look threateningly at Lisabeth. "All right then, for now. Come on guys. We can drink somewhere else!" They turn as one and stalk off. "Is that what happens when you kiss guys, Lisabeth?" Carolyn teases. "I can see why you don't like to -- "Um, so, thanks so much, Clark," Lisabeth interrupts. "They were ... a bit scary. So you invited your girlfriend down for a visit?" Chloe speaks up. "That's not quite it. Clark and I are old friends. I needed his help for ... a story." "Ohhh." Lisabeth leans forward and flashes her eyes at Clark. She switches on her new Voice. "It was very dramatic the way you took care of those guys for us. They said you're a jock too -- you certainly have the build for it -- and you used to play football, but you're not at all like them, are you?" Clark's eyes drop to her chest and he blushes. "I have a feeling you're more the kind of guy who gets girls out of trouble, instead of into it. Am I right?" "Well, I'd hope ..." he begins, blushing more deeply. Chloe sees what Lisabeth is doing and is steaming mad. "I'm sorry Carolyn, but, Clark, now that you're here, shouldn't we be going?" Chloe suggests, glaring at Lisabeth. Lisabeth protests but returns to her normal speaking voice. "Oh, please don't leave yet. Those boys could be waiting for me right outside. I think we need to stay for awhile and stick together. I feel much safer with Clark here." "If you ask me, Clark, I'd say Lisabeth here can take care of herself. Just look at her." Clark immediately complies. His eyes range thoroughly over her body, and Lisabeth obligingly helps by keeping her arms relaxed and twisting her shoulders to ensure he sees all the angles. "Um, I think Lisabeth does have a point, Chloe," Clark says finally, his eyes now securely attached to Lisabeth's piercing blue gaze. "What got them so worked up in the first place?" he adds, pretending ignorance of Lisabeth's obvious attractions. "It was a little game we were playing -- all for a good cause -- but it got out of hand. I'm glad Carolyn and you gave me a good excuse to stop it. I really didn't know what to do to get away from them." "Poor Lisabeth," Carolyn says, patting Lisabeth's hand. Lisabeth feels a slight wetness. Carolyn had just wiped her mouth after a swig of beer. Lisabeth raises her hand to her mouth and sucks on it. [GOOD! LINGUISTIC BRAIN INSTINCTIVE INTUITIVE INTERPRETING UNDERSTANDING ... FILTERING.] GATACATTABXCGATGAATGTCAAT.... "She wasn't always like this," Carolyn is explaining. "I hadn't seen her for a month, and see how she's gone from average to extra-large, with muscle too and more than a bit of sex appeal -- even though I'M NOT into the female brand, Lisabeth!" "Noted, Carolyn," Lisabeth says, feeling a new set of sensations through her brain, a new sensitivity to communication. She keeps her eyes on Clark. "Though maybe she's not into only girls now," Carolyn adds mischievously, her eyes dancing between Clark and Lisabeth. Lisabeth too has become keenly aware of the dynamic between Chloe and Clark, one which is plainly asymmetrical. Perhaps it would not be too hard to make it even more asymmetric. "That kind of growth sounds a bit weird to me," Chloe says. "'Wall of Weird' weird," she adds in a whisper that only Clark hears above the din. "Maybe you should see a doctor," she adds in her normal clear voice. Lisabeth looks hurt. "Now you're saying I'm weird? Sick? You don't think I look sick, do you, Chloe?" Lisabeth says firmly, careful not to sound like she's attacking her and then, to give Clark another excuse to look at her, she leans forward and adds, once again making her voice as sexy as she can, "Do you, Clark?" she concludes, her Voice giving an extra emphasis on his name, which makes Clark shudder. His eyes sweep around Lisabeth's dramatic curves, and then lock onto her chest, his brain whirling, struggling to gauge the full depth of her full breasts. His eyes stray to consider her rounded biceps and then resume their reconnaissance around her body as he ponders in what possible way she could be said to be unwell. He can't think of a single one. In fact, he is having some trouble thinking. "Ummm, no. I don't think so," he says at last. Realizing only now that he's staring he turns to Chloe. "Y-yes. Yes. We should go." Lisabeth nods and extends her hand to Chloe. "Well, I'm sure it's fine out there now. So ... nice to meet you! Good luck with your story." Chloe takes it reluctantly and smiles plastically. Lisabeth rises and stands very close to Clark, but she does not extend her hand this time. "Bye, Clark. I'm really glad we've met. And thanks so much for helping with those boys." He smiles, unsure whether to shake her hand, kiss her or do nothing. He settles on the last as the safest, but just before they separate, Lisabeth leans forward and kisses him on the cheek. "Bye!" she repeats. "For now," she adds, very, very quietly. She can tell by the way he walks away that he heard every word. 22 It is nearly eleven o'clock. Jennifer is in the basement of the student center, having just finished leading the women's self-defense class, and is rearranging the mats. She hears a door open and a heavy tread on the stairs. She checks the exits and moves toward one of them, on the opposite side of the entrance to the room, which she unlocks and opens. The other door opens abruptly and Lisabeth enters boldly, her hair glowing, her face red from the harsh wind, although she is wearing only a sweater, flaming bright red and hugging her body tightly across her chest, displaying the shape of the breasts that she well knows draw Jennifer's eager attention. Jennifer looks at them fixedly and then coldly raises narrowed eyes to Lisabeth's face. "So ... it's you. Finally. Well, I knew you'd come around." Lisabeth walks toward Jennifer confidently, at an even pace, not speaking until she's almost next to her. "Did you?" Lisabeth looks around the room as if it holds just as much interest to her as Jennifer does. It is so familiar but seems so much smaller. Everything, everyone is smaller. Even Jennifer. Especially Jennifer. Jennifer watches her. She wants to keep the door open, to show Lisabeth there's nothing between them that needs privacy, but looking at Lisabeth's astonishing body, her wildly feminine curves, her dazzling hair, her eyes, her voice, she can't close off the possibility. She wants her more than ever. She closes the door to leave that possibility open. But not very open. "Oh yes," Jennifer says coldly. "You're here to test the 'new' you on me, don't you? To show yourself how you've moved 'beyond' me. But you haven't, you know. You're just backsliding, back into the mainstream that I helped you crawl out of before it drowned you. Well you're welcome to it. To be an anonymous object of male desire, to let them slather you with their scum. Go ahead. Get dirty. You won't get what you need from them." "How do you know what I need?" Lisabeth replies haughtily. Jennifer can't know how much she has gotten. What there is for her to get. "I'm nothing like what I used to be!" "Oh, I know. I've always known who you are and what you needed. Why do you think you come around here? Even though you complain that I hurt you? Time and time again. In public and in private. At meals and in bed. I know you far better than you'll ever know yourself, than anyone will ever know you. And you can't resist it. As big as you may have grown, I'm still the one who knows the tender, vulnerable, meek little Lisabeth inside. I know her very, very well. She can't help getting hurt. Anyone can hurt my little girl, but when I want to I take care of her, talk to her, kiss her and protect her, better than anyone ever has or ever will. Who else would you trust to do that? Why else have you, you disgusting meat-eater, you pandering sex-goddess-whore, come back to me now? For praise? For admiration? Or for what you really need?" Lisabeth feels Jennifer's scorn as a body blow. What right does she have? Why can she still hurt me? I am so much more than she is. But a small voice inside, not ABX, no, her old friend, the one that she hasn't heard from for days, weeks, since ABX, wants Jennifer. 'Being big, being strong can't protect me. Only Jennifer can,' it says. "You know it's true, don't you, darling?" Jennifer can feel Lisabeth's uncertainty. She's winning. Lisabeth hasn't a chance. [SHE IS SO STRONG IN HER SELF-BELIEF HER SELFISHNESS IS ALL SO KISS HER.] [Never. It would be so weak. It would prove to her she's better than me, that she has won.] [YOU MUST OR SHE WILL WIN.] "You can't contradict me. You don't dare even talk. You never could. You know I'm right. You'll give me what I want, because it's the price you have to pay." Jennifer grabs Lisabeth's right breast. "Ah, look what I have. Look what you've grown for me." Lisabeth's eyes flutter. It's happening all over again. Even now. She wants to crush Jennifer, but one voice pleads for her to submit, to bear the pain for the peace that will surely be hers, if she can only please her. [KISS HER!] Lisabeth closes her eyes and bends down to kiss Jennifer, but instead feels a stinging slap across her cheek. "A kiss?! After what you've done to me? Turning MY friends against me? Three students tonight at self-defense class. Twelve persons at the last group session. That's it, in this university of 20,000 students! Because of what YOU said about me! You'll have to humble yourself far more, little girl, before you get a kiss from me!" Enraged, Lisabeth whirls and slaps back, her strength lifting a surprised Jennifer off her feet, although her practiced fighting skills take over and she rolls with the blow and falls onto the mat clear of Lisabeth. She springs to her feet and holds her hands up defensively. "Shall we try it? Do you want to see what my little orange belt beginner can do against a black belt? I won't hold back, darling, I promise. We'll see how pretty you look to the boys after I'm finished with you." She whirls and feints with an elbow and shoves her knee into Lisabeth's stomach and slides out of range. "Ha!" she cries out. Lisabeth is startled but not badly hurt. She rubs her stomach where Jennifer hit her and follows Jennifer slowly around the room, watching for an opening. Seeing one, she charges, and Jennifer flathands her in her breast while Lisabeth hits the side of Jennifer's chest with a glancing blow before she rolls away. It hurts. "You can't hurt me, little girl. You can hardly even see me without your glasses." Lisabeth blinks. Why, she doesn't know. She really doesn't know. She turns toward Jennifer's voice and blinks again. Jennifer moves toward her, feints a kick and then kicks hard at Lisabeth's knee. Lisabeth jumps back and then catches Jennifer's leg. She pulls hard, feeling Jennifer's well-toned muscles strain against her, but they are no match for Lisabeth's and she pulls higher and twists. Jennifer lets out a cry of pain and hits at Lisabeth, but she has no leverage for her blows. Lisabeth drops Jennifer's leg and watches her limp painfully, barely able to support herself. "Damn! Fuck!" Jennifer curses. "That was dirty, owww, mean!" "No meaner than hitting my breasts." "That's for flaunting them in my face," Jennifer replies. Lisabeth approaches. "Stay back!" She flails with one arm and Lisabeth catches it nimbly. "I do see better now," she says calmly, squeezing Jennifer's upper arm and bending it around. Jennifer turns awkwardly, hopping on her good leg. "Owww. What are you DOING? I can't fight now." "I know. I still can." She wraps her other arm around Jennifer's chest and starts to squeeze. "Does this hurt?" Jennifer shakes her head. Lisabeth increases the pressure. "How about this? This?" She's squeezing very hard now, using her new muscles, pushing up and down on Jennifer's flat chest, straight through to her bones. Jennifer is groaning. "Ow. Oooh. Can't breath ...what are you doing?" There's a loud snap and another cry of pain. "Aaggh. You broke something." Lisabeth feels strange inside, a quiet amazement. She lets go of Jennifer's chest. "What's wrong with you? Are you sick?" Jennifer gasps. "I need to get to a doctor, right now. And you'll have to carry me there." "It's a rib, I'm sure." Lisabeth says, walking around Jennifer. She holds her steady. "But I promise, this won't hurt a bit," she adds, smiling, and pulls her against her lips and kisses her hard, her tongue roughly invading Jennifer's mouth. [YES PROCESSING SINGLE-MINDED SELFISHNESS HIGH PERCEPTIVITY LACK OF EMPATHY. SURVIVAL FOREMOST FILTERING] ABXAAGACTTAGACCTGCAGGTACTA.... Lisabeth feels odd, as though everything around here is becoming clearer and clearer. Decisions are so easy. Facts are facts. Opinions may be just opinions but mine are right. It's all so obvious. She feels stronger than ever and she knows just what to do with her strength. A small voice inside questioning what she is about to do grows fainter and fainter. And then it's gone. Her mouth is wet with Jennifer's kiss. She looks down at the gasping, limping girl. "You've seen the weakness in me for years and used it to get what you needed," Lisabeth says simply. "I've been abused." She pulls Jennifer into the air holding her roughly under her arms. "I've always hated you for that." "You always knew that. But you accepted it, because I gave you what you needed." Jennifer says. "Owww. You're hurting me!" "I know. I'd like to hurt you for years, but that's not practical. And you wouldn't let me, at least not the way I let you." Jennifer struggles to get free but Lisabeth holds her arms rigidly and any movement in her good leg sends shooting pains up the one Lisabeth twisted. Lisabeth smiles and lays her down on the mat, still holding her arms. "What's gotten into you?" Jennifer says, frightened by the look in Lisabeth's eyes. "You have, darling." Lisabeth says. She pins Jennifer's arms under her knee and covers her mouth and nose tightly with her hand. With her other hand she punches her hard, with all her strength, several times in the stomach, the hard floor below forcing Jennifer's body to absorb all of the terrifying force of the blow. With the first punch Jennifer's body contracts , her legs rising weakly. With the second her eyes roll. She no longer resists but coughs weakly, her body convulses in pain. With the third and the fourth there is little reaction. Lisabeth removes her hand from Jennifer's mouth and wipes the blood onto her gi. She's not breathing and there's no heartbeat. She kicks Jennifer's purse next to her and removes $80 from her wallet and leaves it open beside her, then turns out the light and leaves by the back door, walking away quickly. She circles the campus and returns to Crystal's room, where she had been until 10:30. "Did you find her?" she asks, half asleep, wearing a t-shirt and panties. "No, I waited for her in her room but she never came back." "Good thing you still have a key. I told you she probably was teaching a class tonight." "Yeah, but I didn't want to see her, not with other people there. You know how she can be, especially if she has an audience." "I know. But I think it's really good of you to make the effort, though You have to expect she won't react well to the changes in you. You're stronger and more confident now. Jennifer has to be the one on top." Crystal snuggles against Lisabeth's breasts. "For me, it doesn't matter at all. Top or bottom, left or right, up or down, wheeeee," she squeals as Lisabeth lifts her up and starts kissing her, working her way up her stomach to her breasts with her tongue while easing a finger inside Crystal's panties. "Oh, I LOVE my super-lizzy." "And she loves you too, Cryssie." 23 "How did you get so strong, Lisabeth?" Amanda says in jealous admiration. "A month ago we were about even. Now you're lifting, what, seven times what I can do! Everything we're here you seem to be able to do another 50 pounds. It's unreal." "I suppose it is, Amanda. Can I spot you?" "Sure. I feel almost embarrassed to be lifting these tiny things after you, though." "Don't be. We're not competing." "It's a good thing. Uoof! Uh oh. Here's somebody who COULD be competing with you! Uoof!" Lisabeth looks where Amanda is pointing. "Duane! What a loser! Why would you ever think that?" "You keep avoiding him and it makes him madder and madder, ever since you sat on his -- uooff! -- lap in the dining center." "Just because I made him come he thinks he owns me." "Well, he is a guy. Uoofff! What did you think you were you doing with him?" "Exactly what I did." "UUooof! Um, yeah, but, I hope you don't mind my asking, but why, if you don't like him? She stops lifting to rest ... and talk. "You still DO prefer girls, don't you." Lisabeth doesn't answer quickly. "So ... you have to think about it. That means something," she teases. "I'll tell you exactly what it means. Girls are prettier and more fun to cuddle. They smell better, know more about how to please me, are more interesting and fun to talk to, and, generally make better friends. But there are some things only a man can do for me." "Yes, that's the problem, Lisabeth. That's what straight women always struggle with." "It's not a problem, Amanda. I'm not looking for a relationship with a man." "But I've seen you chase a few recently, since you broke with...." she trails off. "I'm sorry. I was going to mention Jennifer." "I know. Don't worry about it." Lisabeth gives Amanda a hand to stand up and they walk away. Duane takes their place at the machine but keeps looking at Lisabeth. "I know you'd already broken up with her." "It doesn't mean I don't still feel it." "Of course not. But I hope you don't feel responsible. You couldn't have done anything." Lisabeth smiles. "You sure?" Amanda turns to her quickly. "I know you're strong, but the person who killed Jennifer must have been a real maniac. If you had been there anything could have happened." "If I had been there I would have taken care of her." "I know you would have. Any of us would have." She sighs. "Are you ok?" Lisabeth nods and puts her hand on Amanda's shoulder. "You want to go out for dinner? I can't face dining center food tonight." "Sure." She looks over her shoulder and watches Duane doing curls. "Hey, Amanda. He uses lighter weights than I do. I think I'll say something to him." Amanda digs her nails into Lisabeth's forearm. "Don't!" Lisabeth laughs. "Like you could stop me if I wanted to?" But she goes straight to the locker room with Amanda. It is later that evening. Amanda and Lisabeth are eating dessert. Amanda is sighing happily. "That was SO good. I can still taste the spice in the chicken. What WAS this place before?" "'The Cat's Dog.' I went once freshman year, before I'd met any of you." "Really?" She looks off into the distance. "I'm just thinking about when we first met. You were so shy, shut down, and so reticent about yourself. You always let Jennifer do all the talking for you. At first I thought you were a Jennifer clone, except for the reticence. It was only little by little that you started expressing yourself." Lisabeth nodded, letting Amanda talk. "And now, now that you've, I don't know, 'developed' so much in the last month, I feel like some seed that you have in you has just ... sprouted." "That's an interesting way to put it." "Well, I don't really know any other way. I've never known of any woman developing the way you have, not even around puberty when our bodies were changing so quickly. I hope I'm not embarrassing you, talking about you like this." "No." "I mean you grew seven inches practically overnight, developed muscles as big or bigger than any guy on campus, a killer figure and a way of walking and holding yourself that is so damn sexy ... and then of course the confidence, the sharpness -- not that you weren't smart before." "They say that a good dose of hormones, female hormones that is, does make you smarter." "Oh yes, I read that in a newspaper," Amanda says sarcastically. "Someone should tell my calculus professor. Are you sure you haven't been abducted by aliens and -- "Enhanced??" Lisabeth laughs. "Here? In Kansas? Of course! I'm the first one they'd come to! Because I'm an alien myself." Amanda looks at her alertly. "From out-of-state." Amanda nods. "Right. My mother's from Iowa and my Dad went to Canada once. Well, be sure to give the real aliens my address when they stop by again." She shakes her head. "So, you have nothing to tell me? You're not going to sate my curiosity?" Lisabeth looks hard at her. It is tempting to have someone to tell, someone besides the voice in her head. [NO] "No." [Not tonight.] Amanda looks back at her. She knows there is a secret but what can it be? Someone has entered the restaurant and has captured Lisabeth's attention. Amanda follows her gaze. "He's cute," she says mischievously. Lisabeth's color is rising. A blush fills her angled cheeks. Her breathing quickens slightly and a tantalizing scent wafts arond the table, first mixing with the coffee and dessert, battling it for supremacy and then vanquishing it, filling the air around them. Heads turn to face the two girls and linger on one of them. "Lisabeth!" Amanda says in a voice just above a whisper. Her friend is just barely on the aware side of a trance. She tugs at her sweater, fixing her bra which is suddenly rubbing against her erect and highly sensitive, aroused nipples. Her nostrils flare and she shivers. "Lisabeth!" Amanda repeats. Her own skin is crawling too and her lips tingle. What is she feeling? Amanda swallows, trying to keep it down, whatever it is. "I have to talk to him. Excuse me," Lisabeth says, her voice low, dripping with sex. Amanda tries to say, "OK" but her throat won't let her and she nods quickly, awkwardly. All she can do is watch helplessly as Lisabeth stands, turns and walks away. "Why, oh why is she leaving me?" Amanda mourns silently, a small island of reason inside her feeling more confused about her sexuality than she has ever been while all her remaining energies focus on the receding, swivelling bottom of the blond amazon of sex honing in on her prey. And she watches. He is in a corner of the room, talking to a waitress, who is slowly and somewhat reluctantly conceding a few details about a meeting she had been to last week. "No. I didn't really know her. I'm not one of them, you know," she adds, hoping that it's obvious to Clark. "But she knew her stuff and was a really good teacher. Tough with us, but good. I'm really going to miss her classes." "Was there anyone new that night? Anyone unusually skilled? Or unusually strong?" "No. Actually all of us girls were pretty bad. Some of the regulars weren't there, probably studying for exams. Her girlfriend wasn't there either. I heard she'd been going through a lot of changes and they'd broken up." Clark's eyes are glazed and he is staring. "Excuse me?" She rotates her shoulders to make her "B" cup breasts shake, trying to regain the strapping boy's interest. "Um ... I'm sorry. I don't know what I ..." "Hello Clark." Lisabeth says, her voice rumbling Clark's heart and male organs. The waitress is staring at her. Lisabeth gives her a quick glance and turns her full attention to Clark. She leans over to give him a kiss on the cheek and her breasts briefly rest on his shoulder. He is swimming in her tantalizing scent. Even the waitress notices it. She wrinkles her nose to block the unwelcome intrusion and turns her head, impatient, annoyed that she has so completely lost his interest to another woman, one who seems slightly familiar, but .... "Um, Lisabeth," Clark says. "Hi." "Lisabeth!" the waitress says, snapping her fingers, suddenly very pleased. "Jennifer's girlfirend. Ex-girlfriend, I mean." She puts her hand on Clark's shoulder. "They're lesbians, you know. They're only into other girls." Lisabeth looks down at her with complete disdain. "I'm sure Clark knows what the word 'lesbian' means." She puts her hand on a particular spot on Clark's neck and her fingers massage it ever so lightly, sending shivers of pleasure down his spine that converge in his increasingly tumescent organ. "And I'm even more sure that he knows exactly what we're getting into." "L-lisabeth," Clark says with difficulty. "I don't think this is the time or place for us .... She tickles his neck a little longer and withdraws her fingers, but still stands very close to him, her breasts separated from his shoulder by a mere sliver of air. "Yes, for us. Of course not, sweetie. Sorry. I don't want to embarrass you." He looks up at her, disoriented, lost in her gaze. The waitress sniffs. "Hmmmph! "Well, SHE sure looks strong. If you like lesbians with big muscles, then, well, what can I say?" She stomps off. "Is that how you see me, Clark?" Lisabeth purrs, instinctively adopting a new tone with him. She has positioned herself so that Clark is now in the corner. Her large body hides him from the direct sight of anyone else in the restaurant. "You don't really mind these lil' ol' muscles, do you? I know they look big, but we know they're not as strong as yours are," she says softly, gently curling her fingers around his upper arm and tracing her forefinger around the middle of his biceps in a slow, circular motion. "We both know that, don't we. I bet you can be sooo hard, so much harder and stronger than a girl can be. I know I beat you before only because you were distracted. Isn't that right?" "Well ...." A strange conflict rises in his mind. It would be unsporting and ungentlemanly to make an excuse for losing, but it would also be untrue -- and in a sense unmanly -- for him not to be sure she knew that he was, in reality, far, far stronger than she was, even with her spectacular musculature. He couldn't let her think that, not really, not when what he really wanted was to .... "You didn't mind, do you?" "N-no. Of course not." All he can see now is Lisabeth. Her wide shoulders, her spectacular breasts, her narrow waist and broad hips, which constantly shift position to display ever-changing variations of her dramatic curves. Her brilliantly blue eyes seem to look into his soul, reading secrets within hidden even from himself. Her hair, bright yellow, wild, thick, flying, like the aura of the sun. He blinks. That hair. He had found it in the student center, when he was investigating. She knew Jennifer; she had been her girlfriend. Her ex-girlfriend. She wasn't in the class that night. But she must have been there. He looks more closely at her, training his eyes on that wonderful hair more intensely. "You like my hair," Lisabeth remarks, noticing his intense gaze. [ENERGY SO MUCH ENERGY LIKE THE SUN.] [I feel it too.] "Mmmmmm. It feels so good when you look at me like that." "You ... Lisabeth ... the night Jennifer was killed. Were you there?" She takes two deep breaths. "I was with a friend. Studying." [He knows. How?] ABXAGGTACGTATTGCCTGAATCCC .... Lisabeth sways, woozy. [What are you doing? He'll get more suspicious.] [FINGERPRINTS SMALL CHANGES TO GENETIC IMPRINT] [Smart.] He looks down at her hands. [That feeling again. His eyes.] [HIS EYES HAVE ENERGY] She raises her hand to his face. She won't hide. "You like my hands, Clark? You know what my hands can do ...?" Her fingerprints weren't there. But her hair was. How? Unless it was there from earlier. On her clothes, her body. If she hadn't washed them. For how long? His mind is whirling. It couldn't have been Lisabeth. It couldn't be. Still, the spell is broken. "I ... have to go," he says. She holds his arm to stop him, not by force but by touch. "You're trying to find out what happened to Jennifer." "Chloe asked me to help. Jennifer's father is important in the State. It's a big story at the newspaper." Lisabeth nods. "It scared a lot of people." "What about you?" Her heart is pounding. "I'm scared too," she says. Honesty is best, safest. She is scared right now. How does he know? "But I'm a big girl, you know. I can take care of myself. Most of the time." "Well, be careful. Take care." She knows the mood has changed. She can't fight it, not now. "You too." How much longer can she hold him there? She has to think of a way to get him back. "I knew her very well. If you ever want to talk about it." She scares him. She has secrets too. How could it be her, though? He doesn't want to know. "Yeah. I'll call you." He reaches up to kiss her on the cheek and flees. Lisabeth watches him. Pursuit now would only drive him away more quickly. Boys are so simple. She returns to the table. "He sure left quickly. What happened?" "I think I frightened him away," Lisabeth says, her voice back to its normal timbre. "If you want him, I'm sure he won't be able to resist you. He'll call." "I don't know about that. He's different." "He's a man, isn't he? Trust me, Lisabeth. If you don't know it already -- but you must know -- you're irresistible. Even I can't resist you." Amanda smiles. Lisabeth puts her hand over Amanda's. "We'll see." 24 He doesn't call. 25 Mike is feeing a bit sad. It is early November already. The freshmen girls are nearly settled into their routines. Most are no longer as lost and lonely as they were in the first weeks. The ones who still are tend to be dull or fat or have poor complexions. It will be several months before the transfers arrive, and most of them will arrive with enough experience to recognize what he is after and how little he is liable to give back. Just a few more weeks of pick ups and then it will be another nine months before the next flock arrives. Two pretty girls walk past, chattering happily. One sees him. Her face stiffens. She whispers into her friend's ear, and now they both glare at him. Girls! Always gossiping. And even if he had been with one of them, why hold a grudge? He thinks it was the taller one he had, but he's not sure. They both look a bit familiar. The girls walk away. Another girl, very tall, was standing near them and is looking at him. Who is she? She looks familiar, but he knows he has never had any girl that tall. She's more than a head taller than the other two. She must be taller than he is. Had she grown? Possibly, but she is so beautiful. She doesn't exactly seem his type. The tall girl nods at him and then walks off in a different direction. Too bad. He shrugs and walks away. A minute later he sees the tall girl again, looking right at him. Well! "Hey, pretty girl! What's up today?" he ventures bravely. She answers! "Not too much. Work, a research paper," Lisabeth replies. She points at the other girls, now disappearing into the library. "I heard them talking. They sure don't like you." "Really? Well, it takes all kinds, doesn't it?" he says slightly nervously. She IS big, and she looks athletic too. But what a rack. "What kind are you? Are you like everyone else or are you special, your own person?" Lisabeth laughs awkwardly. "I feel sometimes like I have a little bit of many different people in me, but I think I can be my own person. Sometimes at least." "So, you don't just do what others tell you?" "I have a little voice inside that kind of tells me what to do, but I think mostly I should just do what I want. I tell myself I'm big enough to do that, don't you think?" He nods vigorously. "Well, then ..." "Mike," he adds helpfully. "Mike," she repeats. "And you can call me Beth. "Beth," he repeats thoughtfully. "You seem familiar, but you must be new here. I'm sure I would have noticed a girl like you if I'd seen you before." Lisabeth shrugs. "Well, I'm a junior, but," she tugs at her coat with her gloved hand to even out the creases where the shape of her bust stretches it, but only succeeds in pulling it more tightly over her curves, "you might not have noticed me before. I've matured only recently." He nods sagely, trying to keep his tongue in his mouth. "I bet that takes some getting used to." He indicates a direction with his eyes and she nods and they head toward the edge of campus, where his apartment is. "Yes," she says vaguely. "So many changes. Everyone looks at me so differently. It's hard to know just who I am anymore." "Well, I'm sure you're still the same person inside that you always were." "Do you think so?" she says, sounding both a bit anxious and also relieved. "I really hope so, but I don't really know!" She bats her eyes at him and steps closer. "You seem different from most guys, like you really are listening to me, and maybe like you really understand me." "Well, perhaps I do, maybe better than you understand yourself. I'm a couple of years older than you are. I've seen a lot of things, known a lot of people." "You seem really experienced. Oh! Where are we?" "Just a couple of blocks from my place. The way you were walking -- I thought this was where you were headed too." "Oh, silly me. I was just following you, I guess. I can see it's very easy to just let you take the lead." She looks down, embarrassed. "You must think I'm a real idiot. A total nothing." "Not at all. You're very pretty, you know, and I'm sure you're very intelligent. But perhaps you're a bit unsure of yourself, especially around new people." "I am! But it's so easy to talk to you. I bet -- but, oh, you probably have a girlfriend don't you. The nice ones always do." He shakes his head. "It's ... a long story, but ... no. Not now." He looks away, suddenly very sad. "Oh, I'm SO SORRY! There I go again, saying the wrong thing! The stupid thing!!" She starts slapping her leg repeatedly, hard. He grabs her hand and holds it still. "Stop that!" She looks at him. "Don't hurt yourself, please, not for my sake!" She nods, bites her lip and keeps her arm tight, rigid, letting him keep her from hitting herself any more. "Do you want some coffee? I have some good java at my place. And it's a bit chilly out here. We can talk more inside." She doesn't answer. "Come on. I'm worried about you. Hurting yourself like that. Do you do that often?" "Well I ..." She looks down at the place on her leg where she struck herself and touches it as though it was tender from other similar episodes in the past. "Maybe I should go back. You must think I'm sick. Sick! Or crazy!" He pats her arm. "Don't go. Please! We can talk. That would be better than being alone, wouldn't it? Especially when you're feeling this way about yourself." She looks at him suspiciously. "Why are you being so nice to me? I don't deserve it. I'm stupid. Ugly. Weak. Everything I touch turns bad. You'll see. I'll end up messing up your life too." "Beth, really ... I don't see how that could happen. I'm a strong person. I can take care of myself." He looks at her. "It sounds like you've been going through a lot of changes lately. I think you need a bit of guidance. You need to have people around who care about you." "You mean you ... I mean, you think you'd ...." she begins tentatively and then stops and looks embarrassed. She mutters to herself as though he wasn't there. "He must think you're a total idiot. Come on, Beth. Be social. Be nice! Don't be so self-obsessed all the time." She smiles brightly. "Sure! Coffee!! Great idea! Where?" She holds out her arm. Mike pretends he hasn't heard her talking to herself. He takes her arm and leads her to his apartment. She walks in and he locks the door behind them. "Not a great neighborhood," he explains. She looks around at the bare, dismal room. "You don't have much furniture." "Not anymore. She took just about all of it." Her brow furrows in sympathy. "Oh! That sounds really mean. Sooo, you just use the bed?" "Pretty much." Lisabeth nods. "Ooookaaaay." They stand in the apartment for a moment, looking at each other. It's not the same blanket, but the same style and cheap color. He looks so different to her, two years later, now at least five inches shorter than she is. Seen from above, his hair is already thinning. "So, you said something about some, uh, 'java'?" "Right!" He opens a bare cupboard. "Whoops! I guess I'm all out. Sorry." He checks the refrigerator. "How about a Bud?" Not waiting for an answer, he takes two cans out. "But you said ..." she begins and then looks guiltily from side to side. "Well, I don't know. I don't usually, but I think I can. I mean, I know I'm not strictly legal, but I AM a big girl." She laughs awkwardly again at her joke. "Sure you are. Hey, you can relax. I won't bite. It's not that cold in here. Take your coat and stuff off." She removes it cautiously, revealing a tight pink sweater, and holds out her hand. She is still wearing her leather gloves. "My hands are cold," she says apologetically. "I'll warm up later." "Sure, sure," he says, paying attention only to the shelf of breasts she has revealed. He opens the beers and hands her one. She drinks several large gulps and burps. "Ooop! I am SO sorry! It's SO bubbly." He laughs. "That's beer for you." He takes a few sips too and watches her steadily drink down the rest of the can. "Wow! That's really good. I was SO thirsty, I guess." She moves her head a little unsteadily and undulates her torso showing how it's affecting her. "I think it's making me a little tipsy," she giggles. "Oh, that's ok," he says reassuringly and puts his beer down. "You know, I find you very attractive." "You DO?" she says, a bit loudly and laughs awkwardly. "I mean, thank you." She looks down at her chest and smoothes her sweater over her bust to get rid of the creases. New stretch marks appear. "I'm kind of big there now," she says, embarrassed, apologizing. "It happened all of a sudden. I had to get new clothes and everything and now even they're tight." She holds her breasts with her hands. "They makes me feel really clumsy. But boys like them, right?. Men I mean. They're always looking at them. I don't know why." She shakes them and giggles. "Funny, aren't they? They move around so much." Mike nods. "Uh, yes, they sure do." Something about her simple naivete seems familiar, although most of the girls he picks up are like this. He puts the thought out of his head. "I know! And I'm even wearing a bra, one of those really strong, heavy ones that, ha ha, probably attract lightning bolts. You'd think it'd hold them in place but no, it sure doesn't! Hey, can I have another one?" Mike quickly opens another beer and she drinks nearly all of it down, even more quickly than the first. [WHAT VALUE HERE? HE SEEMS INFERIOR] [Shut up. He's a manipulative little piece of shit.] [DECEPTIVENESS CAN BE USEFUL INTOXICANT AFFECTING LISABETH'S THOUGHT CLARITY EMOTION CO-ORDINATION COMPENSATING] [You go right ahead.] She laughs and puts her hands over her breasts, tugging at the bra. "And sometimes it feels so tight. You are so lucky, not having to wear one! You have no idea." "Um, if it's making you uncomfortable, you could, uh, take it off." "Ha ha. You would like that, wouldn't you? Then they'd really bounce around like crazy. Then you could see them. Wouldn't THAT make you happy! Really happy? Gee I'm talking a lot. I don't usually talk a lot. Is this the beer, or is it you?" "The beer doesn't make you do anything you don't really want to do, you know. Maybe it's telling you it's good for you to let go, relax a little." "You THINK so? Ha ha! You would! But maybe you're right! You could be, you know. I'm always so much in control. Listening to the little voice that tells me what to do. I don't have to listen, do I?" Mike smiles. "You're an adult, not a child. You can do whatever you want to do." "You think?" She finishes the beer in one gulp. "Who the hell cares what you think!" She laughs and he laughs too, a bit uneasily. She shakes her chest side to side and her breasts bounce widely. "Yeah! Just look what these babies here do! Ha ha. And just look at those eyes of yours watching them." She does it again. "I bet I'm giving you one of those 'hard-ins'." "Hard ons. Uh, yeah" he says, adjusting himself. "It's a hard on because you're turned on, and it's a hard-in because it's INside," she laughs. She reaches out and grabs the waist of his pants and pulls him hard so that he is thrown against her, his chin just above her breasts. She hardly moves and he bounces away slightly. "Whew! And if you had your pants off it would be a hard out, right?" "Uh yeah, sure!" "Like this!" She shakes her chest. "Breasts in." She pulls off her sweater and stretches, two of the buttons in the middle of her blouse pop open. "Breasts out!" Mike is watching in shock at the mass of flesh suddenly emerges. His heartbeat doubles. [YOU ARE SEDUCING HIM DON'T UNDERSTAND HE IS OF LITTLE VALUE.] [How right you are.] "Oh! Still just bra-out." She reaches behind and her chest thrusts forward at him. She unhooks herself and lets her breasts push the cups forward and then eases the straps off her shoulders, letting the bra fall to the floor. "Breasts out now!" "Oh ... g-g-god!" Mike says, his jaw open, his eyes goggling at the size of the massive, firm, pink globes bobbing in front of his eyes. "You DO like them," she said gaily, triumphantly. "You look like you've never seen breasts up close. You HAVE seen breasts before, haven't you?" she asks, sounding a little disappointed. "I mean, you ARE experienced, right?" "Oh, you can be sure, Beth. VERY experienced. But I have to tell you .... Yours are so big, so round, so beautiful. I've never ... seen any like them before." "Not even a little bit like them?" she asks, playfully swinging them so that they hit Mike's face. "Ha ha! I HIT you!" She swings them again. "Got you again!" "Hey, c'mon," he says. He takes her shoulders to keep her from swinging, but she easily twists away and hits his arm with her breasts again. "Can't stop me!" she teases. "Hey, Beth, really!" he says, disconcerted that he can't make her stop. "We, uh, could be doing better things."" She hits him twice more and then stops. She stands still. Her face is red from the exertion, her eyes are bright. "Better? Like what?" Her breathing is slightly elevated, and in the sudden stillness the only things moving are her chest, rising and falling with each breath and the slight bobbing of her incredible breasts. "I want to kiss you," she says suddenly. She bends slightly, wraps her arms around his back, pulls him closer and joins her lips to his. [FILTERING FILTERING BRAIN INFERIOR PERCEPTUAL ABILITIES INFERIOR PHYSICAL NATURE HIGHLY INFERIOR DISSUMULATIVE ABILITIES HIGH.] AGACCTAGCTCGABXATCCGATGCAATGA.... She stares blankly for a few moments and then comes to. A sly, knowing smile crosses her face and just as quickly disappears. "You know, Mike, you're wearing a lot more than I am. Why's that?" [TIME TO LEAVE.] [Sorry. I'm the one driving. You'll just have to wait.] "I ... I, well, you uh just got ahead of me. That's all." He unbuttons his shirt and strips it off quickly. "There! I'm even with you now." "You are. Sort of." She sashays around the room with a sexy walk and peels off her gloves, tossing them on her coat. She inspects his body carefully, slowly, making him self-conscious. It's not a bad body, much better than Jake's, although far short of Jock's. Average, or maybe slightly better than average, she decides. "We're soooo different," she comments finally, sliding into her new, sexy voice. Mike laughs uneasily. "Well, of course. You're a woman; I'm a man." "Yes, but I wasn't talking about my breasts," she says slowly, with emphasis. "I mean, I'm so much bigger than you are. Doesn't that seem funny to you?" "No. It may bother some guys, but it doesn't bother me." "It doesn't bother me," she quickly replies, parroting him. "But you're the man. Doesn't it bother you for me to look down at you? For you to be smaller?" She puts her hand on top of his head and pushes him down a little. "Now you're even littler! "Hey, stop. No. Not at all." She stops and pets his face and then puts her hand back on top of his head, not pushing now. "Oh, sorry. That was mean. But I wanna know. Have you ever been with a woman taller than you?" "I don't know. Maybe." He hadn't actually; he likes to be in control, and smaller women are easier to control. Right now she is controlling things and it is making him uneasy. And something about her hand on his head is making him feel small. Very small. He reaches up to take her hand and guide it down, but instead she holds it up there. "What are you doing? I like touching your head," she says, simply, resisting his efforts to move their hands. Her hand closes around his. "Little Mike's little hand," she says, laughing and starts patting his head using both their hands. "Little Mike's little hand. Little Mike's little hand," she repeats as if making a child's rhyming game. "I'm not little," he says. "Stop it." She continues patting his head. "Little Mike's little hand. Little Mike's little hand," she sings, swinging her breasts into Mike's face to the beat of her little ditty. She then tightens her grip. "Can't get away from me. You can't get away from me!" "This is stupid. Cut it out." Mike can't free his hand and short of punching her with the other one he doesn't know how to extricate himself. "Can't make me. Can't make me. 'Cause I'm too strong for you. Too big and strong for you." She pulls his hand up and yanks him into her while body- slamming him with her stomach and letting go suddenly. Mike flies across the room into the wall. "Ha ha. Look at you!" [WHAT IS THIS? MALADAPTIVE CAN BRING TROUBLE GO] [No] Mike cannot believe the strange turn this pick-up has taken. "W-hat's gotten into you?" Lisabeth strolls across the room undulating with each slow step. "Beer, for one thing," she laughs. "Lots of things." "I think you should go." She makes a face and then extends her body backwards, a dancer's pose, her bare breasts pointing at the ceiling as she theatrically raises her hand high, waving it around. "Why? Don't you like a little foreplay?" "Not this kind," he says, unable to stop staring at her. "Funny. That's also what the little voice in me tells me." She bends low towards him. Her large breasts hang between them. "But I'm not listening. I don't have to listen. Like you said, I'm all grown up. I can do what I want." She steps nearer. He holds out his hands, unsure whether to touch her or stop her. She stands just out of reach and slithers and dances in place, rotating her hips in a slow circle, snapping them hard, back and forth after several rotations and then circling again. "You like this Mike," she says, her voice low, hot. "You like how my body looks, what my body can do." He nods. "Yes, you're thinking, 'This is more like it. This is what I wanted. What I've dreamed of.' Is it? Am I right? Or not?" She is right next to him now, her body grazing his as she moves, undulating, closer and closer. She keeps moving, bumping him with her breasts, her stomach, her hips and her thighs. He tries to stay closer, but each contact pushes him back until he is against the wall. Now she is bumping him with her stomach and hips more frequently, bouncing him every couple of seconds, back and forth between the wall and her body. "Hey, stop that." He grabs her arm. "You're hurting me." "I'm just playing around, Mike," she says, amused, but she stops and looks down at his hand on her arm. "Did I hurt you badly? You worried I might hit you?" "No." "I could if I wanted to. I'm very strong, you know." "I don't know what's gotten into you. No one's hitting anyone." "But I could, you know. You couldn't stop me. Not in a million years." "Hey, uh, let's not get carried away. Sure you're big, but I was just being careful. You're a girl, a woman, I mean. I wouldn't want you to get hurt when we're fooling around." Lisabeth stares down at him, not saying anything. "Yeah. Sure." His hand is still on her arm exerting a slight pressure to hold it in place. Her breast, so round and firm, bobs a fraction of an inch away from his fingers but he doesn't lift his hand to touch it. "You are afraid of me," she grins. "If you weren't you'd be touching my big, beautiful breast." She shakes her body so that it bounces against his hand. See, it's right here," she says in a teasing sing-song voice. "Don't be ridiculous," he says, his hand now carressing her bobbing breast "Well then you should be. You don't know what I'll do next. I'm big. I'm strong. I'm drunk. Anything could happen." "I can handle myself. And you. But why should I be afraid of you?" She smiles, raises her arm and begins to flex her biceps, fed by days and days of more sun-rich energy, bathed in ever more potent ABX-devised hormones, honed by hours of harsh, uninterrupted training, now endowed too with the suppleness and fluidity of a dancer. They rise with the majesty of the summer's cumulo-nimbus thunderclouds that bring the threat of deadly lightning, pummeling hail and drenching rain to the blissful warm summer day. Not cloud soft, but anvil-hard. "Because of these, Mike. What do you think, Mike? My muscles have muscles bigger than yours. And that's my weak arm," she says casually. "Um, er, very impressive," he stammers. "Awww, that's so SWEET of you to say so!" She wraps her arms around him and hugs him, letting him feel her erect nipples rub against his hairy chest. She is aroused now, excited about where this is going, and her scent makes him gasp with desire. His legs not long enough for his erection to reach her sex, it instead pushes between her legs. "I can FEEL that. How cute!" She holds him closer and closer, her arms squeezing his back, crushing him into her chest. "I love the closeness, don't you? Your warm body pressing against my sensitive, ooooooh VERY sensitive breasts." She squeezes more tightly. "I could just squeeze you to bits!" "Aaaaaagh! AAAAAAAAAAGH!" Her fingers press into his back, finding the pressure points and playing them like notes on a piano. He squirms desperately but can't move. "Mmmmmmmm, MMMMMMM" she moans. "Yes. YES! touch me JUST like that! Oh MIKE, you REALLY know how to please me!" Out of breath, his back twisted in pain, he starts beating his fists against the sides of her back, just below her wide, muscular shoulders, the only part of her he can reach. Immediately she pushes him away. He slams into the wall. "What was THAT?! What the FUCK was that!!" he says angrily. He gasps, coughs, tries to breath, coughs, sputters, wheezes, coughs again, groans and then breathes deeply several times. "Damn it! DAMN IT! What do you think you're DOING!" He is still breathing hard. She looks at him impassively. "Why, hugging you, Mike. Touching you. Did I do it wrong? Was I too passionate?" [WE DO NOT NEED TO DO THIS IT IS OF NO ADVANTAGE.] [This is obviously something you don't understand.] "You nearly KILLED me!" "Awww! Really?" She steps closer. He shrinks back. "Are you scared of me now?" She takes his hand gently and softly carresses it and then runs her hand up his arm. "Is this nicer? My pretty hand all soft and nice on Mike's arm." She touches his forearm and then his biceps. "There, there. Nice Mike. All better? He nods. "Good." She caresses it still more lightly. He relaxes and even starts to become aroused again. His breathing quickens and he inclines his head toward her body, kissing her shoulder and starting to work down to her breasts. The taste of her skin is dizzying. He must have more. She laughs a little cry of pleasure. "Ooooh, that's nice Mike. Uh huh. Yeah, you know, it's hard to believe my arm used to be smaller than yours. Yeah, really. Oh, don't stop. Small and soft, you know. I studied karate, with my women's group, yes, keep going, but I was still so much weaker than a man I was still so scared of them. Yes, a little lower. And now it's hard to imagine being so soft and weak as I was before. Or even as you are." She takes his arm and twists it. Once again he gasps in pain as she forces him to turn around. She forces it higher. "No! Stop! Owww!" "It's so easy to do it.. I'm so much stronger than you now." She makes him bend down. [THIS IS DANGEROUS IF WE ARE CAUGHT WE WILL LOSE FREEDOM] [We -- I -- won't be caught.] [THAT STRONG ONE ALREADY SUSPECTS US] [I know that.] [HE'LL COME AFTER YOU HE'LL ........ OH! OH!] [Uh huh.] [It's getting to be time.] "What are you doing to me!? You'll break it. Beth! BETH!!" She lowers his arm slightly. "What did you just call me?" "Beth. Beth! You said your name is Beth." "Did I? Most people call me Lisabeth." She spins him around to face her and holds his shoulders tightly. "Lisabeth," she says more firmly, in a loud, clear voice. "Lisabeth." Forcibly turned to look at her as she says the name for the first time, his face snaps to hers and he stares at it, looking for something that he recognizes, and then he sees it, the features of Lisabeth's soft blonde prettiness at the base of the powerful, devastatingly beautiful woman she has become. At the first repetition of her name, a wave of fear passes through him, leaving him queasy and weak. The second hits him like a bolt of lightning and he shudders, barely able to stand. "Lisabeth?" he asks. "So you do remember me? From my freshman year? The 'sad pretty girl' you were going to help, to teach how to get on at this strange place? What you did to me ...." He looks up at her and then slowly down her powerful body. "I ... I ... I didn't force you to ... I'm not --" "Even after your sickening come on, using your so-called experience and knowledge to manipulate me, make me feel so small and dependent, so STUPID if I didn't gratify you in the most pathetic, degrading way, and then, to ignore me, abandon me, when I STILL came to you for help and advice...." She shook him like he was a doll. "Do you have ANYTHING to say for yourself?" "I think ... you really ... shouldn't ... I mean ... can't we settle ... like grown --" "Like mature human beings. Well! I've grown, Mike. Don't you think?" She bears down on his shoulders, twisting his body, and he screams in pain. "Quiet!" She glares at him and puts her hand on his throat. "I've heard enough of your voice to last me a lifetime, and I plan to live a very long time." She squeezes his throat, first on his Adam's Apple. His knees buckle in pain, but she holds him up by the throat, and she squeezes harder, but not to choke him. Her fingers search for and expertly find the muscles at the back of his larynx, pulling and weakening them, crushing the cartilage, damaging and deadening the nerve endings. She lets go and he slumps the floor, struggling to breathe. "Wh-what ... have you --" he says, his voice low and horribly garbled. "What does it sound like I've done, darling?" she says clearly, her voice honey-sweet. "My ... my voice. I ..." he croaks and grips his throat in evident pain. "I've ruined it, darling. Permanently. In fact it will just get worse and worse as the nerves die and the muscles atrophy and wither away. Now, I'm just wondering what ELSE can we do together!" [AND NOW YOU MUST KILL HIM] [Well, duh. But not yet.] Lisabeth is between Mike and the door. There is no way to get away except through her. "You look so distressed! How very SAD! Is something wrong? Are you trying to talk to me? I can't HEAR you! And no one else can either. Oh, just look at your face now! This must be your angry, determined look." He runs at her, fists ready. "Wheee! Here we go!" She blocks his blow easily and hits a quick jab at his chin, spinning his head around. "Feel that? Here's another." She hits him again on the opposite side. "I've been at the gym the last two weeks taking boxing lessons. If I don't wear a bra they give me the lessons free. Six hours a night -- I don't need much sleep, you see. And I'm a very quick learner. Pop! Pop! You're staggering already. Pop! Ha ha. And these are just my little bitty jabs. I've knocked out two sparring partners already with my real punches, with my muscles really behind them. But then, I'm not being fair with you. I had boxing gloves on then, and they're much softer than my fists. Still, the guys I floored won't fight with me anymore. And they don't have to. But you don't have a choice, do you?" Mike is swinging wildly now. Lisabeth dodges him, ducks a punch and hits him with another jab. He staggers again, breathing hard. "You sound terrible. Is your crushed larynx affecting your breathing? Why, of COURSE it is, darling! You're not getting getting enough air and it's tiring you very quickly. Now you can hardly move your arms." He swings again and she makes no move to block him, but he is so tired he can't raise his arm enough to reach her head, and his punch lands below the neck. "You HIT me! Good for you! Try again!" He aims higher and she jumps out of the way. "Ha ha! Again!" He swings and connects with her stomach. "Oooh, solid hit ... but no damage done. Getting pretty weak now, Mike. Or are my abs just too strong? Or maybe it's both." He mouthes a 'please'. "What's that? Please show you how strong 'I' am? I'd be delighted to! I KNOW you'll be proud of how I've 'grown up' and matured so well. Just like you said I should. Oh, what ARE you doing, trying to protect yourself, wrapping your arms around your head? I don't think that little baby trick will work. Well, we'll just have to see how well you do!" She pulls back, sets herself firmly and smashes her fist into his shoulder. He rasps a groan and his arm hangs down limply. "Oh, that didn't sound good. Something's broken there. How about another?" She sets herself hits him again, even harder, three inches lower on the same side. He tumbles backward, rasping more loudly, bent over and she follows him. "I think something else is broken now, Mike, probably a rib or four. Just two punches. Bang. Bang. Aren't you impressed with my strength? Or are you still not convinced I'm all grown up now?" She sighs and runs her long fingers down his throat. "There is just so much I'd like to do with you, Mike. And so little time." She takes his other arm and holds his hand, lacing her fingers through his as he tries to pull away. "You have small hands, you know, compared with mine. My bones are really strong, like iron. Thick, hard, nearly unbreakable I think." She squeezes and the bones in his hand crackle and then break. He makes a pathetic rasping sound. "Well, yours certainly aren't. You're breaking all over." He is whimpering, crying.. His face is puffy, bruises are starting to appear. His arms hang useless, his posture bent like an old man. He shuffles painfully, trying to move away from Lisabeth but she follows him around the apartment. "You don't look so good now. Not nearly as good as the day we first met, you know. You were cute then. You had me thinking then you were different, really nice. But you weren't and you aren't. And now you're about to die. Are you ready, Mike? Ready?" He is shaking, frightened and in deep pain. "Ready Mike? Ready?" Lisabeth repeats, not interested in any response. She stands over him, waiting until she feels it is time and then she reaches high and slams her fist down the middle of his back using all her weight and her considerable strength. There is a loud groan and a raspy rattle. He falls, his arms and legs splayed out awkwardly. She kneels down next to him and listens. "You're still breathing, but with your vertebrae broken in two and judging from your posture, I'll guess you're fully paralyzed now." She feels his back and probes a few pressure points. "Yes, you would be twisting away screaming if you had any feeling left." She tries a few on his neck and then comes down hard on his "good" arm, breaking it above the wrist. "No feeling there either. Looks like I'm done. I'll hazard a guess you're not expecting any visitors tonight. It should be a few days after the weekend before they start looking for you. It'll probably be the smell that draws them." She stands up and walks around the apartment, putting her bra, blouse and gloves back on, collecting her coat, tidying up the beer cans and tossing them into the overflowing garbage bag. "No fingerprints or lipstick on the beer. Plenty of hair around from other girls as well as mine. When DID you last change the sheets? OK. Good to go. I won't call you this time, Mike. I promise. No, the next move is completely up to you." She leaves and the door locks behind her. [HE'LL COME FOR YOU NOW] [Yes. He'll have no choice.] 26 It's a warm, late autumn day. Lisabeth, Amanda, Vrema, Valerie and Crystal are on line for breakfast at the dining center. Amanda has a bowl of fruit, toasted wheat bread, without butter, and coffee. Crystal has a bowl of cornflakes and one fried egg. Valerie, guiltily as usual, has a cinnamon roll, frosted flakes and hot chocolate. Lisabeth, last in line, has a full plate of scrambled eggs, toast, bacon, toast, orange juice and a banana. She also takes a blueberry muffin, now a daily tradition. Valerie looks enviously at Lisabeth's tray. "How can you eat that and still look the way you do!" "I have the right genes, Valerie. And I'm still a growing girl," she says as they walk to their table, her skirt swishing. A special, large, and artistically styled chair, hand-made for her by an architecture student highly skilled in carpentry and design, awaits her. His reward, a private half hour with Lisabeth, left her with additional dividends -- she would do a far better job on her next chair, which she will make herself. "You should be careful though, Lisabeth. You stand out so much." Crystal giggles. "And that skirt! I warned you about wearing it!" "That's not what I meant!" Valerie protests. "Is sex the only thing you think about? You do call it sex, right? Whatever it is you do." "It's still called sex when lesbians do it, Valerie," Amanda says, keeping a straight face. "But I mean with another of these murders. That guy they found. Who knows how long he'd been there? I hear he was kind of a creep, but still ...." "He deserved it," Lisabeth says loudly. "I went out with him freshman year, and believe me, I'd kill him all over again if I had the chance." Valerie is too shocked to speak. How can she speak like that, after Valerie's own sister was killed. "But Lisabeth," Crystal says, serious. "You don't really mean that, do you?" "It's just talk," Amanda says. "I can understand what Lisabeth's saying. I know someone else who dated him. He took advantage of, um, people. It's nothing like poor Jennifer." "But do you really think a woman could have done it?" Crystal asks. "Or maybe someone's brother, or boyfriend, or father even," Valerie suggests, wanting Lisabeth to acknowledge Jennifer in some way. "The story said whoever did it was extremely strong and knew a lot about anatomy, like pressure points and stuff. They said his windpipe was crushed so he couldn't speak," Vrema says. "His larynx," Lisabeth corrects. Amanda looks at her sideways and takes a long sip from her coffee. "Nice weather today," she says. As they leave breakfast Clark approaches Lisabeth. "Excuse me Lisabeth, but can we, I mean, we have to talk." "All right, Clark. If it seems important to you." She puts her arm around his shoulder. It stiffens slightly against her touch. Crystal frowns but says nothing. "But we have Psychology in ten minutes," Valerie whines in protest. "We'll have to go over your notes together later, then," Lisabeth says. "Come on, Clark." Clark lets her lead him to a quiet spot on a hill near her dorm. She kicks off her sandals and sits on the ground in the sun and pats the grass next to her, beckoning him to join her. He continues standing. "Come on. You have something to say to me. You don't have to be so far away to say it." She leans back, her hands on the grass and stretches her chest up toward the sun, showing off her profile to its best effect. "It's really lovely down here. Don't you think so?" "Lisabeth, this isn't easy for me." "What's wrong, Clark?" she asks sympathetically, her voice acquiring a new timbre, as though she would give up her whole being for him. He feels the tones vibrate deep in his chest. "You look so troubled. What can I do to help?" She extends her arm toward him and flutters her fingers. He looks down at her, her blouse is nearly transparent in the sunlight. He wants to look away, but he can't. The wind plays with her hair and then dies down. "Cla-ark," she called to him, her voice still softer, but even larger, surrounding him in a cloud of beauty, enveloping him in a mist. There is a mist, that scent again. The scent that whispers mystery, that promises sweetness, that opens a door to pleasure, that touches something deep inside him, a secret within himself that until now he had not known existed. Chloe did not have it. Nor did Lana, who once had meant mystery to him. Once, but he had penetrated her secrets long ago and found her wanting, far too limited for his needs and ambitions. And for his capacities. But how can he compare either of them to Lisabeth? Chloe, whose loyalty and goodness were a match for his, maybe better, who still had a crush on him, but whose body and plain, midwestern manner held no more charm for him.. Lana, whose girlish figure he had once found so alluring, had a strange power to hold his interest, but never to command it. He had grown up with both of them, but they were, compared to Lisabeth, still mere girls, mere shells of the woman Lisabeth is. He sits. "Here you are," she said softly from somewhere deep inside him. "And here we are. No one will disturb us." He looks at her and breathes, concentrating his energies. "Lisabeth, the murders here, both of them, you -- She is stretching out her arm, her long, rounded arm, the smooth curve of her bicep a twin to the curve of the voluptuous breast that refuses to hide from him, that he sees as clearly as if she had removed her t-shirt. He tries to go on. "You were there. They were your ... "And WE are HERE, Clark." Her breathing quickens. "You feel it too, like me, I know you do, don't you?" she asks, knowing he won't answer. Another wave of her scent hits him, nearly floors him. It comes from another part of her now too. All his powers, all his invulnerability, cannot shield him from his own needs; his needs have his powers too, as mighty as his wish to resist them. Her fluttering hand is on his chest, her fingers slipping inside his shirt, so gently, as if the strength of her muscles, far larger than his, did not exist, yet her touch runs like lightning through him. With all his strength, he cannot move that hand or stop its fluttering as it dances lower and lower down his torso. But still he struggles. "You can't ... it's not right that ... if you ... I must ...." "WE must, Clark. WE MUST." He isn't sure if she actually said it, or if she had beamed that thought directly into his being, but he senses it throughout, wants to obey it, wants to disobey it, but her fingers, her slender fluttering fingers, are opening his pants and now touching him inside them with a power stronger than the immense steel crushing strength of his muscles. The feelings are magic. Her power is magic, a power he cannot resist. Or is that power actually his? His desire, giving her human fingers magical powers far beyond their mere physical strength. He has something he must do ... but must he do it first? "Let me," she says, in that same Voice, and before he knows it, she has completely freed him from the protective prison of his clothing and encased him, swallowed and protected him in her own, hidden him within herself. He cannot believe what has happened, so quickly, so easily. Her diaphanous pink skirt flutters around them. "There's nothing but me underneath," she teases, moving on him and around him. "Just let me. Just let me. Then we can do what you want. What YOU want," she repeats, her body, inside and out, moving around him more quickly, her words in perfect tune with her undulating body, all of its parts feeling so soft, looking so round, so delicious to his eyes, while inside she was taking him, surrounding him, squeezing him, pulling him, touching him, never letting go. "What you, what you, what you WANT, what you want, what you want," she repeats in her Voice, speaking directly to his soul, to his desire, more powerfully than his own thoughts, while her skirt flutters higher in the wind, its pinkness tangible, and inside she is pressing harder and faster against him, his body beginning to buzz with his desires and its needs, so long suppressed, always suppressed. "No, no," he says, holding up his hands to stop her, but instead of pushing her away, they land on her breasts and instead of pushing her, they push them, squeezing, touching, feeling. All of him is feeling her. "Oh yes, baby, yes baby, yes. Do it. DO it. You can DO it. DO it!" she cries. He mustn't. The consequences. Unknown. Pregnancy. Other danger to her. He must be in control. Her fingers clutch at his body. "No, no. Oh NO!" he says in all too sudden defeat, as the long pent up stream of his cum bursts from him, while his orgasmic pleasure bursts within. "Yes, ooooooh yes!" she cries, her own orgasm pulsing around him. Her arms circle him in an ecstatic hug. "Ohhh!" [OH YES YES OH OH OH OH PERFECT ALWAYS THERE WHAT TO WHAT IS IS NOT IS NEW NEW HOW TO MUST START START] ABXGACCKCCKTTATCCRAYGGPTPTAAACATOOTGNTTPAACATGATKNGTNTTKNYGTTACYCCGRROTTGKKA CT TT.... "Ohhhh..." she cries and goes limp. "Lisabeth. Lisabeth!" he says, climbing off her. She is sprawled on the ground, her eyes are open but unseeing. Her breathing is short, labored. "Oh no! What have I done?" he says to himself. He dresses hurriedly and arranges her skirt on her more modestly. Her t-shirt is still on. He looks around him. No one is there. "Lisabeth," he repeats. [Colors. Sounds. Sensation. Lightness.] [A START A GOOOOOD START BUT NOT NEED MORE MORE MORE] [Happening. What's happening?] [CAN'T FINISH CAN'T MANIPULATE YET.] [What should I do?] [NOT READY YOU'RE THE DRIVER DRIVE] She blinks. She feels as though she's just swallowed three cups of double espresso. "Wow." She looks up at Clark. "Wow." "Lisabeth! Are you ok? I thought I -- She sits up. "I'm fine. Very fine." She takes a breath, a deep breath that strangely feels unnecessary. Her mind is racing. She remembers and smiles. "Mmmmmm," she says, her voice back to normal. "You seem ... I was worried for a moment. I'm sorry if I -- She leans back and closes her eyes, taking in the sun. Her skin tingles, on fire but not burning. She pulls her t-shirt up, baring her waist, and then her skirt, stretching out her bare legs on the grass. That's even better, so much better. The sun is so good to her. She can still feel herself throbbing inside, where Clark was. Not bad at all. She could do that again sometime. But not now. It wasn't anything important. Not compared to what has just happened. And the sun. "Lovely day," she says, the rising sun warming her. She opens her eyes and looks up into his. "You were saying?" "Lisabeth, you're so beautiful." She inclines her head slightly in acknowledgment. "If I took advantage --" "It's our secret, Clark. I won't tell ... if you won't." "I wouldn't!" Her eyes twinkled. "Oh? Not even ... Chloe?" He swallows. He has no secrets from Chloe, at least none he has been able to keep. "Not even Chloe," he affirms. "Good." She brushes her calf with her toes and his eyes follow. [Already? He's got a lot of energy. But I feel that way too, like those espressos keep pumping through me.] [ESPRESSOS? YES THEY ARE] "But Lisabeth, still, we have to talk. I mean, those murders. Jennifer Conners and Mike Johannson. You were in the places where they were killed." She misunderstands him, deliberately. "Of course I was. I used to go out with Jennifer and I went to her classes every week before we broke up. And Mike, a bad, ugly person. I was in his apartment a lot, freshman year when I saw him." "I mean," he says with difficulty, "you were there more recently. You were there ... when they were killed." "Why do you think that? No one else says so," she says, challenging him. She pauses and adjusts her t-shirt to pull the tight sleeves up to her shoulders, leaving her biceps uncovered. She flexes them, mostly to try subtly to intimidate Clark, but also because she is curious about what Clark and her "other voice" have done for them. She is disappointed to see that they look much the same, but there is a different feeling, as though she could hold them in that position forever. She continues speaking offhandedly, but keeps them fully flexed. "I talked to the police about Jennifer -- but only because I knew her well. No one else blames me for what happened to Mike, even though everyone knows how I feel about him. He deserved it. And very girl who knew him -- the way I did -- feels the same way." He is looking down at her arms, eyeing her muscles, her huge round muscles, so much larger than his, and rock solid, like she is in top physical shape. He's grateful for his powers. He may have to use them, soon. "There's evidence. You left evidence." She looks at him with a fixed smile. "And you have it?" He is sure of it now. But, he thinks guiltily, looking again at the curves of her full breasts, he always was sure. And even though he was sure she was the killer, he made love to her and would again if ... but no, he couldn't. He couldn't possibly. He stares back at her. He can't back down now. "I do." She relaxes her arms but continues staring at him, waiting for him to say more. "You should turn yourself in. They'll go easier on you that way." She laughs. "Are you joking? Even if I HAD killed them, which I DON'T admit, I would NEVER do that. And neither you, Clark, nor anyone else will ever convince me otherwise." She rises to her feet slowly, gracefully, enjoying the sensation of rising above him, looking down on him. She extends her hand to his chest again, a single, long, slender finger gently touching it, but it's a different kind of touch from just before, one that says 'be warned.' He looks down at her finger and his eyes travel up past her rounded forearm, lingering for a moment on biceps that still bulge powerfully even though they are now relaxed and up to her cannonball shoulders. Yes she surely looks strong, abnormally so, for a girl, but none of that human strength will matter if he must use his own unearthly powers to protect others, as he has sworn he will do. "Lisabeth," he says, quietly, but firmly, stepping away from her, "I can't allow you to continue. You have to answer for what you've done." "What you think I've done," she replies. "You have no proof. You have nothing. Come on, lie down with me again." But she knows he won't, not now. He looks up at her. "We'll see about that," he replies, his eyes steady and fierce. She stares back, challenging him to do more. But no, he decides. Now is not the time. There is evidence. He can put the evidence together and confront her again. It will be better that way. But he will have to watch her closely until then. 27 "I'm sure it's her. It has to be." "But Clark," Chloe replies, "you said her fingerprints don't match what was found near Jennifer Conners, and there were no fingerprints at all at in Mike Johannson's apartment. How can you be so sure?" "Her hair for one thing -- "But there are other explanations for that, Clark. You know that." Clark sighs. "I know. But something about her response to me. It seemed that she wanted me to suspect her, and then when I voiced it, she was so cool about denying it. Not upset, not panicked, as if she had planned everything and this was simply the next step." "She could simply be emotionally detached, Clark. Or just shocked that you accused her. Or," she adds, biting her lip. "she could be using her body and her, you know, sex appeal, to manipulate you. Look at the way you've responded to her. You have to admit it, Clark. You find her very attractive. I'm sure she knows it." "Umm, yeah, well...." Clark says, embarrassed. Chloe looks at him, barely hiding her disgust. "No. Don't tell me. I REALLY DON'T want to know." 28 "Lisabeth," Crystal says sleepily. It's past three. Why are you still up? Is something wrong?" Lisabeth puts a comforting hand on Crystal's round rump and rubs it. "No, sweetness. Everything's fine. I'm just not tired." "After what we did earlier, I thought you'd be completely relaxed. Ohhhh. MMMMMhhhhhhhmmmmm," Crystal says, slipping back into sleep, as Lisabeth rubs her some more where she knows Crystal likes it. She leaves her hand, motionless, on Crysal for half a minute, until she knows she is fully asleep and then turns back to what she had been watching through walls, trees, the Science Building, the football stadium and tens of sleeping persons: It's Clark, over a mile away, in Mike's apartment, painstakingly searching the floors and walls. She smiles. "Oh you are suspicious, aren't you Clark, but about entirely the wrong things," she says to herself. "I have secrets too, and mine are much bigger and more dangerous than those you are looking for, as you will learn soon. Very soon. Whether you're looking for them or not." ABXAGATTATACKGATRCCTAYCAATGPPTTGOGTTCGTAATNNN.... [Oooooh, you're at it again, aren't you? What new toy have you given us now?] [CAN LINK WITH ALL THINGS ALL THINGS POSSIBLE JUST LIKE AT THE BEGINNING. EYES CAN LINK US. EYES CAN CHANGE ALL WITH THE WHITE LIGHT. THE LIGHT OF THE BEGINNING.] [What does that mean?] [WE ARE SAFE NOW AND SO POWERFUL MORE THAN EVER BEFORE BUT ... NEED MORE FROM HIM] [Sounds good. But what exactly can I do, other than see through walls and go nights without sleeping?] [GET MORE AND YOU WILL SEE] [So, now you play games too?] [WE LEARN] 29 It's eight-thirty. Crystal wakes up and groggily looks at Lisabeth, staring at the wall, wearing a smile that is just this side of hysterical, mad laughter. "Lizzy! Lizzy!! What is it? You never went to bed! Are you -- Lisabeth turns to her with a look that could melt comets. "Oh sweetness! You would never believe the disgusting gross things George Bush does when he wakes up in the morning!" Crystal looks even more concerned. "Oh no, darling. Don't worry. I'm fine, absolutely fine. Are we having breakfast together today? It's Tuesday, your English class isn't until 10; my Media Studies is 11, not that I need to go, but we have time, plenty of time." She dives back onto the bed and playfully wrestles Crystal down and starts licking her quickly. "Lizzy. Lizzy!!" she squeals. "I have to get ready. Miss Richards hates me, and if I'm late .... O-O-O!" Half an hour later, Crystal is leaning against Lisabeth in the shower, her head against Lisabeth's breast. "Oh god, you've really done me this time so I can hardly stand up. Where do you get all this energy? Are you really OK? Like ... I heard that-- -- crazy people are unnaturally strong and don't need much sleep?" Lisabeth bends down and lets Crystal look her directly in the eyes. "Well, do I look crazy to you?" "You look happy. But I don't know why you're so happy or why you couldn't sleep," she says. "I mean. if you don't want to tell me ...." "Oh, dearest, darling Cryssie, I DO want to tell you but I CAN'T yet, but, believe me, I will tell you, just not yet." [NO] [Shut up] "Well, OK." Lisabeth picks her up like a toy doll and kisses her. "OK so long as I wake you up like this every morning?" Crystal kisses her. "You'll kill me if you do that. But," she pauses, "it'll be worth it." 30 "Miss Collins, may I see you after class today?" Lisabeth looks up at Mr. Ross, her Media Studies professor. "Is there a problem?" "I don't think so. But let's discuss it then." Lisabeth grimaces. She would miss the best sun of the day, and no matter how wonderful she feels, soaking up the sun's energy makes her feel even better. The thought passes her mind that she shouldn't be greedy. Another follows: why not? Why does she even continue at school? [WHY?] [Because my friends are here, and I like them.] [WHY DO WE NEED FRIENDS WE ARE SO FAR BEYOND THEM] [It's fun for me, and that's why I'm staying.] [MEDIA STUDIES IS FUN BIOLOGY -THIS PRIMITIVE, PASSIVE BIOLOGY-- IS FUN?] [For now.] [WE SHOULD BE GOING TO FIND HIM] [No. He'll come to me. It will be better that way.] [WE NEED HIM] [I'm not Listening to you.] "Miss Collins, are you listening to me? I asked you whether the media's approach to the Iraq war represented a new era of independence or subservience." Lisabeth blinks. She stands and speaks in a loud, clear voice. "Subservience. Establishment media, even media commonly understood as acting as a voice for the opposition to the Republican administration, blindly accepted facts of seriously dubious provenance and provided both backdrop and cheering section for national subservience to a partisan so-called "faith-based" political agenda. The facts were available, no one wanted to know them, and the media proved a willing collaborator in ignoring them." Mr. Ross gapes. "Yes, although a few independent weblogs and periodical -- Lisabeth interrupts. "You asked me about the media. Obviously if one samples the entire universe of opinion you will find counter-examples. The Nation. The website Salon. Or are they the 'media' you wished to discuss, rather than the common middle ground of television and cable networks, multi-media conglomerates, large and small city newspapers we have been studying all semester?" "Without criticizing your response, my observation was intended to ... er ...." Lisabeth lifts her arms and stretches lazily, pushing out her chest. Only a few students look at the Professor. "Yes. You're well-made. I mean, your point is well-made." There is a smattering of laughter. He stands behind the podium, halting his usual pacing in front of the class. "Yes. Are there any, um, comments on Lisabreast's, um, Lisabeth's, no, Miss Collins's um points." He blushes and the class laughs loudly. Herman Kneet, a varsity forward says, "I think her points are outstanding." There is general applause and whooping among the boys. "Gentlemen. Gentlemen. If you would please ... oh dear, the time is up." Lisabeth fixes another glare at Herman and walks up to the front of the room, remaining two rows away from him. "What is it, Professor? I'm in a bit of a hurry." He looks up at her. "Yes. Yes. Oh, I'm so sorry, but ... I was going to suggest my office, but perhaps now, it might make more sex, I mean sense if .... I wanted to say how pleased I am, generally about the improvement in your written work, even though your classroom behavior is incandescent -- I mean indecent, no, inconsistent. For promiscu ... promising students, we can waive some course requirements, make connections with real newspapers, internships, you know, and if you would take me um as ... as your ... adviser I could see if could place your -- Lisabeth rolls her eyes. "Exactly where do you want to place me, Professor?" A new thought occurs to her, She crosses her arms in front of her chest and slowly steps down to the podium, where she towers over the slight, bookish man. She steps closer, so that her right breast hangs millimeters from his nose. "Tell me, if you were my adviser, would you do exactly as I ask?" "Um," he looks nervously, afraid to move his head and bump into Lisabeth's full, slightly bobbing breast, "within normal procedures, of course." She shrugs and turns. "These procedures in many cases have exceptions and special considerations," he adds. She turns back, remaining in profile to him. "I'm sure you agree that I am exceptional and very, very special." He nods. "Good. Then your first assignment is this: my friend Crystal Cummings is having trouble with her English teacher. She needs an "A" in that course. Make sure she gets one on all her papers and exams for the rest of the year. English 143, with Miss Richards." "Miss Richards?" he asks dolefully. "Tough, isn't she? If it were easy, what would your help prove? Or is it too hard for you? Are you not up for it?" "No! I'll do it. But, our first conference ... when we'll we meet ... in my office?" She considers his question and pretends to fix the fit of her blouse over her right breast. "I'll see how you handle this one, Professor, and then perhaps I'll see how much more you can handle, if you're up for it." She turns and saunters out of the room, her butt swaying hypnotically. By the time she has left the building she is just getting over her laughter. In seconds she spots Herman, who is entertaining a group of his friends with an embellished version of his exploits in Professor Ross's class. She strides right up next to him. "That was unnecessary and obnoxious." At 6'7", Herman is one of the few students to be able to look down at Lisabeth. "You're the one who was coming on to him. What do you expect?" he says casually, refusing to take any criticism from her. She quickly backhands a slap across his face and knocks him down, flat on his back. "Why, that's just what I expected. Is this what you expected?" He shakes his head, surprised, and climbs slowly to his feet. "Hey, nobody does that to me! I don't care if you're a girl. If you -- She pins his arms to his sides, picks him up by the waist and tosses him ten feet away. He lands heavily on the ground. "This girl does what she wants." In two leaps she stands above him. "Now, Herman, is there anything you want to tell me?" He shakes his head fearfully. "What a pity. I thought you were going to apologize." She picks him up and lets him stand unsteadily for a moment. "What are you going to do, Herman?" He balls his hands into fists, but there is no strength left in his arms, and he knows it. "I'm going to knock you out now, Herman, and when you wake up, if you wake up, you're going to -- With a rush of wind, something spirits Lisabeth away from the scene to a deserted wooded area of the campus. Briefly startled, Lisabeth quickly realises it's Clark. He is yelling at her angrily. "What are you doing? What ARE you doing? What are you going to do? Kill him, like the others?" Lisabeth is now more curious than unnerved. "How did you do that? And what do YOU think you're doing?" "Stopping you from killing yet again!" "What is WRONG with you? I was just scaring him. And humiliating him, as he deserves. That's all. What's more interesting is how closely you're watching me. From where? For how long?" Clark doesn't answer. "While I'm in my room? With Cryssie? In the shower ... when I'm all naked?" She laughs in a low voice. "Of course not! How can you think I could do that anyway?" "You have no idea what goes on inside of me, do you?" she says now using her 'sexy' voice. She is facing him with her hands on her hips and she shifts her shoulders up and down as she speaks. "You can't help watching me. Look at you now. Where are your eyes, Clark? I'd say you're watching 'them' move? Like any other Peeping Tom, Dick or Clark." "Shut up!" he roars, and grabs her shoulders to stop her moving them. Lisabeth stands still for a moment, letting him take in her closeness, feel the firmness of her body, the roundness of her curves and breathe her scent, and then boldly reaches inside his pants and pats his rapidly emerging erection. "Oh sure! I hear you loud and clear. You're a good one to talk!" He grabs her hand and pulls it upward, out of his pants. "Don't you DARE touch me like that!" he yells, barely restraining himself from using too much of his strength to hold her, or from slapping her and sending her flying into orbit. "Oh, no? Well, I DO dare. What do you think of THAT?" she replies and twists out of his grip, then puts her hand right back where it was. To his complete astonishment she begins rubbing him again back and forth. "Come on, Clark, admit it. Doesn't that feel good? Isn't THIS what you really want from me?" His face is bright red with rage. "NO!!! I ... I ... DON'T ... DON'T you DO that!" He pulls her hand away again, and this time holds it more tightly, tightly enough to overcome any attempt on her part to wriggle away, and, to convey the message that he is deadly serious this time, tight enough to hurt her. She looks down at his hand on her wrist but says nothing, and he is briefly impressed by her stoicism. Still, her determined actions confirm his assessment of her character, as if the evidence were not enough by itself. She is the killer. "I KNOW it was you," he says, voicing his thoughts as coldly and firmly as his grip. "It was your hair there, your skin. The samples were too small for the police to notice it. But I have them, and once I give the samples to the police their labs will confirm it." She looks away. Several miles away, she sees an envelope in Clark's room containing hair. Her hair. She will have to retrieve it somehow and destroy it. "I don't think that will ever happen," she says, turning back to him, her mouth set. She shakes her head and smiles, not in a friendly way. "No, not at all." She breathes in, slowly. Her chest expands. Her breasts rise and they push against his neck and stay in the position. Lower down, he pulses, his erection pushes against her leg. She laughs and her chest moves slightly, side to side. "Stop it!" he orders. He wants to squeeze her hand more tightly but he fears if he holds her any more firmly he will break her bones. She continues to taunt him. "Do you think you can control me? When you're not even in control of yourself, Clark? Of that little bit of yourself that's pushing against me? Nudging me? Asking for more of my attention?" she says, her mouth hinting a sneer. "You think so highly of yourself. Well, I'm NOT impressed." She tightens the muscles of her thigh against him and moves her leg slightly, back and forth. Harder and then harder still. He lets go of her hand and takes her by the shoulders, pushing her away to arms length. But now he looks down directly into the outthrust shelf of her breasts. "Needed a better look first? Do I impress you THAT much?" Enraged, he throws her away from him. She flies ten feet into the air and lands heavily forty feet away, settling in a limp heap. Clark speeds to her side, horrified at the violence of his emotional reaction. He kneels down and shouts, "Lisabeth. Lisabeth!" in full panic, but there is no response. Her eyes are closed. He puts his hand to the side of her head. There is no pulse. He reluctantly uses his x-ray vision to look inside her body. There is no bleeding, but her heart is stopped. He needs to give her CPR immediately to restart it. He stares at her breast-laden chest helplessly. Where to strike without damaging them? He rips open her shirt and her breasts spring out in full splendor, momentarily making him blush with desire. He struggles to focus. There is a job to be done. He finds the right place, pushes her left breast aside and, calibrating his strength carefully, prepares himself to pound on her chest. "WHAT are you doing now?" she says, her eyes open, looking up at him. He freezes. Was she pretending to be hurt? But he threw her so hard, so far. How could she not be hurt? "You DO play rough," she continues. Her sandals dropped off when he threw her, and now she raises her bare foot to his crotch and massages him with her toes. "Ooooh, what HAPPENED to YOU? He got all SOFT and SMALL! Did I frighten the little thing? I know you boys can get VERY emotional when you think you're having trouble staying hard. Were you worrying about it? Does that embarrass you? Were you blaming me? Did you want to kill me? So I wouldn't tell?" He is staring at her. He is so angry, but has no idea how to respond to such nonsense. "Come ON, Clark! Don't tell me you're one of those boys who can't TALK about these things? Is this a SECRET? Oh-ho, I bet you have LOTS of secrets! Did you feel you needed some help? Were you afraid to ask? Did that make you angry? Did you need to look at my breasts more to keep yourself hard? Did you need to touch them? Were you afraid to?" No! NO! NO!!!" he said, shouting, suddenly fearing what she knows. "Just listen to you! There's no need to get SO upset about it! It doesn't matter how strong you are, Clark. You have all the weaknesses all boys have. I know that! I know all about it." She pushes her breasts together with her arms and wriggles her toes against him to massage him. He responds immediately and stiffens against her. "There!" she says, now using her sexiest Voice. "You're so easy for me, just like any other boy. See? Feel better? I'm the one in control. I made you soft, and now I can make you hard." She rubs him more vigorously. "This is JUST what you needed to get hard, right? REALLY hard!" With that, he bursts through his pants, his penis extending toward her, pulsing, slightly wet. And his desire is building higher and higher. [GET IT GET IT ] [Quiet. I'm busy.] "Look at that! HARD and BIG. You DID it, Clark. Aren't you proud? Aren't you a proud boy! A proud, strong boy." She rises, extending her tongue around him, licking him gently, ever so gently, but faster and faster, her tongue trilling against him, withdrawing, and then starting up harder and faster than before. His eyes are dazed. He sighs, almost bursting with desire. She surrounds him in mouth and then, speaking right against it, again in her Voice, "Yeah, you really like that, don't you." She rubs her breasts against his penis, compressing her cleavage around him, taking her erect nipple up and down the shaft. "Don't you want to SHOW me how BIG and HARD he can BE?" He wants to pull away, but he can't. Obviously he isn't trying hard enough. She touches him, putting her hand around his pulsing shaft gently. Too gently! "What's the matter? Can't decide whether you really want me to stop, Clark? I thought ALL boys liked to be touched there, especially young men with their hormones raging like yours are. Touched and rubbed and pushed and pulled and tickled and squeezed ...." While she is talking he wants nothing more than for her to stop, but it feels to him as though his strength, and what's more, his very will and determination, have drained away, while hers has multiplied in power, each tantalizing touch of her fingers leaving him desperate for more. "Ha, ha," she says, her mouth close to his yearning erection, nibbling on it and teasing it with her lips between her words, her tongue like a bow against his string, playing him louder and louder, while her hand tunes him higher and higher so he fears he might snap. "Little Clark ... like putty ... helpless ... so helpless ... waiting ... waiting for me ... while it builds ... builds ... builds ... and builds inside you ... higher ... harder ... more and more ... so hard ... until you can't stop it!" She kneels in front of him and takes him into her mouth and tightens her lips on his shaft when he groans and explodes in jets of hot cum that shoot against the back of her throat. She holds on tightly to the back of his legs, continuing to move her lips up and down against him, milking him, pumping him, urging every last drop. [Happy?] [OH OH OH WITHOUT BOUNDS NOW WITHOUT BOUNDS THERE IS SO MUCH THERE IS NO LIMIT NO MORE LIMIT] ABXGACCKCCKTTATCCRAYGGPTPTAAACATOOTGNTTPAACATGATKNGTNTTKNYGTTACYCCGRROTTGKKA CTTTKRYPTONNOTPYRKABXXBACTGACCTAKROGGTPKAATNOOOATCCTGATACRNNNPRABNNTGXXXXXAB XGACCABXGACCKCCKTTATCCRAYGGPTPTAAACATOOTGNTTPAACYCCGRROTTGKKACTTTABXGACCABXG ACCKCCKTTATCCRAYGGPTPTAAACATOOTGNTTPAACATGATKNGTNTTKNYGTTACYCCGRROTTGKKACTTT KRYPTONNOTPYRKABXXBACTGACCTAKROGGTPKAATNOOOATCCTGATACRNNNPRABNNTGXXKCCKTTATC CRAYGGPTPTAAACATOOTGNTTPAACATGATKNGTNTTKNYGTTACYCCGRROTTGKKACTTTATGATKNGTNTT KNYGTTACYCCGRROTTGKKACTTTKRYPTONNOTPYRKABXXBACTGACCTAKROGGTPKAATNOOOATCCTGAT ACRNNNPRABNNTGXXKCCKTTATCCRAYGGPTPTAAACATOOTGNTTPAACATGATKNGTNTTKNYGTTACYCCG RROTTGKKACTTTABXGACCABXGACCKCCKTTATCCRAYGGPTPTAAACATOOTGNTTPAACATGATKNGTNTTK NYGTTACYCCGRROTTGKKACTTTKRYPTONNOTPYRKABXXBACTGACCTAKROGGTPKAATNOOOATCCTGATA CRNNNPRABNNTGXXKCCKTTATCCRAYGGPTPTAAACATOOTGNTTPAACATGATKNGTNTTKNYGTTACYCCGR ROTTGKKACTTTNNNPRABNNTGXXKCCKTTATCCRAYGGPTPTAAACATOOTGNTTPAACATGATKNGTNTTKNY GTTACYCCGRROTTGKKACTTTABXGACCABXGACCKCCKTTATCCRAYGGPTPTAAACATOOTGNTTPAACATGA TKNGTNTTKNYGTTACYCCGYCCGRROTTGKKACTTTABXGACCABXGACCKCCKTTATCCRAYGGPTPTAAACAT OOTGNTTPAACATGATKNGTNTTKNYGTTACYCCGRROTTGKKACTTTKRYPTONNOTPYRKABXXBACTGACCTA KROGGTPKAATNOOOATCCTGATACRNNNPRABNNTGXXKCCKTTATCCRAYGGPTPTAAACATOOAACATGATKN GTNTTKNYGTTACYCCGRROTTGKKACTTTABXTTGGATCATACTACGATTACAABXKRYPTON [Oh My. Oh. Oh. Oh. My!] [YES YES OH YES] He is still inside her mouth, but his spasms are weaker now, his gasps of pleasure less intense. Suddenly embarrassed, furious that he has let her seduce him again, he pulls himself out of her mouth and turns around so he does not have to look at her. He tries to dress but his pants are torn where he had burst through them. [I feel I am bursting with ... with] [THE EVIDENCE WE SAW BEFORE. OUR HAIR. LOOK AT IT AGAIN.] Lisabeth turns slightly and quickly finds it, still on Clark's desk where it was. She can see it so sharply now, as if it were within reach. [LOOK HARDER] [I see it already] [HARDER] The envelope bursts into flame. It burns brightly for less than a second until it is consumed, charring a few nearby papers and the surface of the table, but the rest is untouched. [Oh. Wow. He can do this too?] [YES BUT WE DO IT BETTER WE ARE BETTER.] [Really?] She laughs. "What's so funny?" he says angrily, turning around to face her, his pants split from the front. She can't stop smiling. "You ... it ... the whole thing is so ...." She looks up at the sun, beaming its energy directly into her. She wants to drink it all in. If only she could swallow the sun too. Maybe she could, if she could only reach it. Does he not feel it too? She looks him up and down. [How can he not know? Or does he simply not understand?] [FROM BASE WE ARE BETTER AND NOW HAVE SAME SPECIAL ENERGY BUT WE OPTIMIZE ALWAYS OPTIMIZE] [Well, don't stop now] He is shaking his head. "I don't understand you, how you make me do ... but all that is beside the point. You have to face justice for what you've done. It's as simple as that." "Oh no it's not!" she laughs. "Justice is on my side. Like the sun." "You're wrong, Lisabeth, on both accounts." He takes her arms, pins them to her sides and lifts her into the air. "I'm taking you to the police, with the evidence." "No you won't." She pushes her arms outward. "Why should you decide? Because you're stronger? What if you're not?" She feels him steadily increase his efforts, but she keeps pushing harder until slowly his arms give way and she slips back to the ground. "See what I mean?" she says. "You can't be -- She steps up against him, crowding him. "Oh yes I can," she says. "You're not! I am!" he affirms. "You KNOW I am." "You're not stronger, Clark. You were before, but you aren't anymore." She places her hands on his shoulders and begins pushing down. He resists and she increases her efforts rapidly, clenching her fingers tightly and using for the first time the new strength flowing through her body. "Oooooh-owww!" he groans suddenly, his knees wavering, his eyes wide with surprise. "But how?" "Mmmmmm. Harder, Clark?" she purrs. "Looks like these muscles ARE good for something, after all." His knees buckle and she bends hers, continuing to press him lower until he is seated, his shoulders pinned on the ground. "How ... can ... you ... DO ... this!" he is grunting, unable to believe or accept his failure to stop her. She holds him down with one arm and one leg stretched across his and reaches through the tear in his pants and starts caressing him again. "And now, should I make you ready for more?" [WE HAVE ALL WE NEED] [I know that but he doesn't. I'm just playing with him. The self-righteous little prick.] "No! Stop!" he says, trying to get up. "What's the matter, Clark?" she sings, her sexy voice, unlabored, teasing. "Are you worried what might happen if you give me even MORE of your secret, special sauce? Do you think you've made me too strong already?" She strokes him, making him grow again. "Look! There he goes!" She rubs him until he is fully hard. His face is contorted. "I gave you your strength?" he says incredulously, trying to twist away. "Oh yes," she says, running her tongue around her lips. "Yum yum, yummy." He shakes his head in horror. "You SOUND mad, but, honestly, you showed me once before how strong you are, and it doesn't feel to me like you're REALLY trying. I think you secretly WANT me to be stronger than you. MUCH stronger, hmmmm? Come ON already, if you really want to stop me. Put some MUSCLE into it. I DARE you! Hey, what's WRONG, baby? Can't you try ANY harder than THAT? Are you COMPLETELY sure you WANT me to stop? Or might it be that those little muscles of yours just aren't strong enough anymore to stop ME from doing whatEVER I want -- to you or anyone else." He wants to scream with frustration, to scream loudly enough to deafen everyone within a mile, but he doesn't dare. "This ...is ... impossible!" he grunts, pushing helplessly against her. "Why?" she clucks. "Herman's bigger than me, and see how I handled him. I'm bigger than you are, a lot bigger. What's more, my muscles are bigger, much bigger. Harder too," she adds, squeezing his biceps with her free hand and then pumping hers, putting it right next to his eyes. She leans against his back, resting her bosom on his neck. "Is it because I'm female? Do you think that, inch for inch, 'female muscles' are somehow inferior to a male's? Or do you think there's something 'special' about you?" Even using all his strength to push outwards he cannot break her hold. "Maybe I'm 'special' too, even more special than you are." She releases him, except for a lingering playful touching of his erection while, Clark looks up at her nervously, fearfully, waiting for what is next. And then in an instant he's gone. "Oh not you don't! I'm not ready for you to leave yet." She takes off after him, rushing invisibly past students, buildings, cars, airplanes flying overhead, keeping him in sight all the time, her legs churning so quickly they barely touch the ground. She has nearly reached him when he accelerates again. Annoyed, she closes the gap and leaps at him, surprising herself as she flies through the air, level to the ground, her speed continuing to increase until she catches up, envelopes him in her arms and tackles him. They skid along the barren prairie ground of Western Kansas and come to a halt, their clothing burned and in shreds miles behind them. She sits on his legs and hold his hands down, pinning his wrists to the ground with one arm. "Gotcha, coward!" she taunts. "Running AWAY from ME!" "You're as fast as I am too!" he exclaims. "Faster. Faster, stronger, and smarter too, obviously. In fact, I'll say that anything you can do, Clark, I can do better." Clark struggles to release his wrists from her grip. She tightens her hold and pushes down harder, the pressure of their hands compressing the earth below. The frustration, the dismay and a little bit of pain are evident on Clark's face. "Awww, it's not THAT bad, is it? You're telling yourself that you MUST defeat me, that I'm obviously 'EVIL', that I'm planning to destroy the world and make all men my slaves?" She laughs and licks her lips. "What an idea! But that's not really what's bothering you. I know what guys are all about. You like to show us girls how strong you are, and now look at you. Aren't you embarrassed? You thought you were the strongest one around, and you're not. You're just the strongest 'man', Clark," she says, "and a pretty pathetic one now too," she adds, pushing around his now limp and shrunken rod with her forefinger and then lifting her hand gracefully up, fluttering her slender fingers so that her bicep ripples in front of his eyes. "Yes, here's a girl, a mere female, who is far stronger than you, who can overpower you with one, sexy arm while she holds the other high in the air doing nothing at all." "What are you?" he moans. "Kryptonian?" "What's that?! Some kind of religion?" she smiles. "No, that's not what I am. What I am is your nightmare." She pushes him onto his back, shoves him into the dirt and puts her foot on top of his penis, wiggling her toe against it. "Look at that. Completely at my mercy. Good! I'm going to -- oh shit! Amanda! I'll finish with you later, Clark." 31 Amanda had been in the gym, working her legs on the stair-stepping machine. On the lunch line, Valerie had told her about Lisabeth's behavior in Media Studies today, describing in detail how Lisabeth had looked and how completely disgusting it all was, although Valerie's bright eyes and somewhat ragged breathing told a different story. Just listening to Valerie and using her imagination sent an electric current running through Amanda's body. She pushed the food away off her try, unable to think about eating, and went instead to the gym, hoping that working her body hard would knock the imagery out of her mind, but it's not working. She commands herself to dismiss the thought of Lisabeth coming on to that Professor. How could she! And why wasn't she there to see it? She is so annoyed with herself. No! Once was enough! Once was fabulous, but she doesn't trust herself to do it again. Letting herself be intimate with Lisabeth would change everything, it would ruin their friendship and worst of all, it would make her completely, wholly and utterly subordinate to her beauty, her strength, to an energy in her that seems more real than anything else in the world. No! She will NOT let the entire world look gray just because Lisabeth isn't there. NO! NO! NO!!! She has stopped moving and three people around her are staring at her as though she has lost her mind. Was she talking to herself? What has she said? She looks past them and almost runs to the locker room where she quickly pulls on her clothing and leaves, keeping her head down. There's no one she wants to talk to now, no one she wants to see. She should shower, change and work on her paper for English Literature, but she can't. She has to keep moving or else she'll start thinking again, thinking about Lisabeth. She walks and walks, oblivious to the sunshine, to the unusual late year warmth, to the buzz around her in the middle of campus and to the quiet in the wooded areas, but even though in her current state she's not conscious of it, she feels happier where it's quiet and empty and pushes deeper into the woods and then through it, toward the barren, open land outside of town. She looks around, surprised at how far she has come. She turns, thinking she's being silly, that she should get back for her poetry seminar at four, when a large shape -- a man -- emerges behind her, moving towards her, running faster than it should. Where is the road? Where is a house? Even a person -- she is thinking when it -- he -- grabs her and easily wrestles her to the ground. "You. You're her friend. I saw you with her!" Duane is saying angrily, holding her roughly. He has covered her mouth with his big hand so she cannot scream and is on top of her, crushing her shoulder with his weight. Amanda's eyes are wide with fear. She could bite his fingers but that would only make him angrier. He could beat her, rape her, kill her right now, and no one would know. WHY had she come here? How could she be so stupid! "You think it's so funny, the way she acts, coming on to us, like that, and then ignoring us." Amanda tries to shake her head - she DIDN'T think it was funny! Not at all, because she felt exactly the same way, even though she expressed it another way, if he could only understand, but he is holding her so firmly that her attempt to twist away only sends shooting pains down her neck and back. "Well it's NOT! It's SICK and it's -- He stops talking and his hold loosens and then he is off her. She can breathe but she is shaking in fear, afraid to move or even open her eyes. "That was really an incredibly stupid thing to do, even for an incredibly stupid person like you, Duane." That voice. Lisabeth. Amanda looks around. Lisabeth is holding Duane up in the air, lifting his massive bulk with just one arm! How can she do that? How can she possibly be so strong? Her shoulder is sore, but Amanda slowly pushes herself off the ground, brushes the damp dirt from her pants, and walks closer. He swings his fists at Lisabeth angrily, but Lisabeth ignores the blows, not even defending herself, although she is getting angrier. Her eyes darken. "WHAT do you think you're DOING!" Her fist clenches and her muscles tense like she is about to punch him with all her strength when her face goes strangely blank, as Amanda has seen many times in the past few months, but then she smiles and looks at Duane. It is a strange look, as though her eyes are not focused on him, but rather in him. She holds that look, deep in concentrated thought, and then she raises her eyebrows and stares harder, and suddenly Duane's body is bathed in light, a white light unlike anything Amanda has ever seen. Duane's face is vacant, his body limp next to Lisabeth. "What's happening, Lisabeth? What are you doing?" Amanda calls out, but Lisabeth doesn't react except to mouth the words "like Jake" several times, her mouth settling into a gentle smile. "Yes, like Jake. Like Jake now. See how you like that," she says more loudly, sounding like herself again. "Oh, but I know you won't," she says quietly, smiling widely. The special light fades. Duane still hangs limply from Lisabeth's hand, but he looks odd, not like himself. She lowers him to the ground where he stands unsteadily, "Come here, Amanda. Closer." "Lisabeth!" Amanda says, relieved, grateful, but unsure and still shaking. " How did you know what he was doing to me? I can't believe you came just as he was going to -- "Look at him, Amanda. Look what's happening!" she says excitedly. Duane's polo shirt, which had formerly tightly hugged his bulging muscles hangs loosely on him, a couple of inches below his crotch. His sleeves look empty. He staggers, unbalanced. His eyes are slowly coming into focus. He pulls at his shirt. "What the fuck!" he says out loud but just to himself; he is too self-absorbed at the moment to take account of Lisabeth and Amanda. His mouth hangs open in amazement. He pulls his sleeve higher and stares in shock at a skinny, unmuscled upper arm whose biceps scarcely twitch when he tenses them, as he does repeatedly, harder and harder, until he has to shake his hand out to get the feeling in his arm back. "He's lost all his muscle! I can't believe it!" Amanda exclaims in amazement, until her emotions kick in again. "You bastard! You fucking bastard!!" she yells suddenly and charges him. He puts out his long arms to hold her away but she pushes right through them and slaps his face hard, turning his head and knocking him off his feet. Amanda follows him to the ground and sits on him, slapping his face repeatedly. He tries to grab her wrists to stop her, but even when he manages to catch them briefly he is only able to partially slow down the movement of her hand and she quickly twists free and starts beating him again. "Bastard! You bastard!!" she says. Finally he simply covers his face with his long skinny arms, but this stymies Amanda only temporarily, until she pulls his arms away and holds them down on the ground with one hand while resuming the beating with the other. "Ha! How do you like THAT?" She punches his stomach and he moans in pain and starts crying. Amanda is about to hit him there again when she stops, her arm poised. She lowers her arm slowly, gets off him and stands up, backing away from him toward Lisabeth and then falls into her arms. She starts sobbing. "It was so horrible," she cries. I didn't know what was going to happen to me. He was so strong. I couldn't do ANYTHING!" "There, there Amanda. That's all right. Everything's all right now," Lisabeth says soothingly, stroking Amanda's hair and holding her. "Sshhh. Sshhh. OK. OK." Amanda is trembling but she clutches hard against Lisabeth and slowly steadies herself in Lisabeth's embrace. "It's fine now. Really. He won't bother you or anyone else ever again. Never, ever again." Amanda is breathing almost normally and she lets go and turns around, looking again at the tall, skinny man, his face red and getting puffier by the second. He stands painfully, not quite straight, and watches Amanda and Lisabeth carefully, keeping his distance. "Is that really Duane?" Amanda asks. "It is. It sure is," Lisabeth says, smiling. "How ya' feeling, Duane? Something you want to say to me? Or Amanda?" He looks at them but doesn't speak. "I'm not ignoring you now, Duane. There must be something you wanted to tell me. Or ask me. Or DO to me." Lisabeth says, smiling and then waving slowly and gracefully, letting Duane look at her long, thick, muscular arm. She holds out her hand, palm skyward, and beckons him to come closer, lightly pumping her biceps. "Come on, Duane. I won't hurt you, and Amanda won't either. She's all finished with that, right?" Amanda nods, not actually that keen for him to get any closer. "You're a witch, is that it?" he says, keeping his distance. He shakes his head. "No. No. I'm talking crazy. This isn't real. There aren't any witches. You hypnotized me, right? Because this," he bares his skinny arm again, "this isn't happening. It can't be happening." "If you say so," Lisabeth says. "What I'm noticing not happening is you hurting my friend Amanda. Instead, what I see is your ugly face swelling up like a balloon after the beating this girl gave you. Show him your muscle, Amanda." Amanda looks at Lisabeth skeptically and pulls her sleeve up. She flexes her biceps and a small but well-formed muscle rises. She laughs, embarrassed, and rolls her sleeve back down. "She works out almost every day. Pretty impressive, hmm Duane?" "Yeah, for a girl, sure," he replies sarcastically. Amanda bristles. "Maybe," Lisabeth replies noncommittally. "But it's bigger than yours, Duane. Bigger and stronger. She just beat you up, and she could do it again if she wanted to." "I don't," Amanda says quickly. "I don't want to beat anybody up." Lisabeth puts her arm around Amanda and kisses her briefly. "Of course you don't. You were just feeling upset before. Upset and frightened. And now you're much better, right? Amanda nods. She loves being held and kissed by Lisabeth. "I know you're not gay, Amanda, but it's different between us," Lisabeth says, reading the expressing on her face. She kisses Amanda again, a longer, deeper kiss. "You can enjoy being close to me without being gay, right?" Amanda feels as though she's melting, like she could flow into and around Lisabeth, like she could lose herself in her and only be more for it. What is that? What does it matter what it is? Lisabeth must be right, and all Amanda wants to do is to surrender to her in any way that she can. "That's disgusting!" Duane says. His words touch a sensitive part of her mind. Amanda glares at him. "You have no right to judge us!" Lisabeth laughs. "That's right, Duane. I think you're in no position to offend anyone, being such a weakling." Duane scowls. "You can go fuck yourself, bitch." Lisabeth kisses Amanda again and holds her securely and warmly. She puts her lips on Amanda's ear and whispers sweetly, "Amanda, dear Amanda, I'm not suggesting that you should beat up that awful, obnoxious boy, because I know you're not a violent person, but he doesn't seem to understand that things have changed. I think he needs to see how things are. Don't you?" Amanda glances at Duane and then looks back at Lisabeth's face. "But Lisabeth, honestly, I don't understand it either. I don't understand anything I've just seen." Lisabeth picks her up with one arm and cuddles her against her breast. "You don't have to understand it now. But would you just show Duane that all this is real? I could do it, but it will mean more coming from you." "You mean, because I'm smaller than you." "Yes, and because of what he just did to you I think it will help you get over it. Don't hurt him. At least, don't try to hurt him. Just knock him down, tackle him, like in football. Wrestle him a little. Do you know what I mean? He's used to it, or at least he thinks he is. That will show him what's real. Can you do that? And then we'll go back." Amanda laughs. "I have five brothers. Of course I know what you mean." She looks at him scowling at her. "He's still a lot bigger than I am." "He's taller, that's true." Lisabeth gives her a little squeeze. "Come on, I want to watch." She puts her on the ground and gives her a little push towards Duane. "This is your choice," Duane says, licking his lips. "Don't blame me if something happens and you get hurt. Any YOU," he says, pointing at Lisabeth, "YOU stay out of it." "Why? Am I too strong for you, little boy?" she teases. "Lisabeth! You'll just make him mad!" Amanda complains. "Won't matter," Lisabeth says casually. Duane takes the offensive and grabs Amanda as he did before, planting his legs to push her down. Except that she doesn't move. He pushes harder, his face reddening as she stands still and watches, the smile growing on her face. "You're kidding, right?" she asks, knowing full well that he isn't. He is as weak as he looks. She takes his wrists and to his amazement pulls his hands off her shoulders and holds them. "Come on, Duane. What are you waiting for?" She pulls him to the right and lets go. He stumbles and falls. She claps her hands. "That was so easy. What a weakling!" She skips over to where he is getting to his feet and lets him stand up, but as soon as he does she runs into his chest with her shoulder and knocks him off his feet, flat onto his back. "Hey, Duane, is that how you play football?" She kneels next to him and pins his arms to the ground. His arms tremble and face reddens again as he tries to pull away, but he can't move. Amanda shakes her head and feels his biceps. "Lisabeth, how can they be so soft and weak now? He was so strong before, but I'm holding him down so easily. It's like his muscles have turned into mush!" "That's pretty much right. I'd guess that if you compared Duane's muscles with Jake Toefel's, they would be pretty much the same, except that Jake's have probably benefited from more exercise." Duane replies through gritted teeth while he still struggles to free himself. "Toefel? Are you crazy? I work out with weights for two hours every day! All Toefel ever does is carry around his stupid math books." "That's true," Amanda says, playing with the small, soft muscles in Duane's arm. "We see Duane in the gym a lot. Remember? This muscle feels like it's never gotten any exercise at all." "It hasn't," Lisabeth explains. "Obviously this isn't the muscle Duane used to have when we saw him working out. That muscle was much bigger, well- toned, tough and strong, scary strong, but that muscle's all gone. This is new muscle completely, brand new, like a baby's, although obviously bigger and more mature than a baby's." "But soft like a baby's," Amanda replies. She forces Duane's hand up and taps his nose with his fingers as she repeats, "'Like a baby's.' But Lisabeth, isn't just a matter of time before he gets his old muscle back? He's still big and he'll go back to working out. Right?" "And be scary strong all over again? Nope. Undoubtedly he worked out hard and often, and that helped grow and strengthen his muscles, but he was also blessed with great genetic gifts. I say 'was', Amanda, because that's all changed. Now his genes give him all the athletic, muscle-building potential of Jake Toefel. I think when he sees that all the exercise in the world makes only a teensy-weensy bit stronger that will discourage him pretty quickly, don't you?" "Wh-h-at are you talking about? What does Woeful Toefel have to do with me?" Duane says, giving up at last and lying down flat on the ground, trying to catch his breath, his arms exhausted from pushing against Amanda's apparently much stronger limbs. "What's wrong with me? I'm so weak. Am I sick? We got Nebraska to beat Saturday!" "Nebraska! You can't even beat Amanda! You're a wimp now, Duane. You've been punished for your sins. Your limbs are as thin as overcooked spaghetti and your muscles are just as soft. How are you ever going to push around a bunch of men who are made of three hundred pounds of solid muscle? What do you weigh Amanda?" "A hundred and five," she laughs. "And I am, NOT solid muscle!" she adds, bending this way and that, relaxed enough, triumphant enough, to flaunt her subtle but very feminine curves, enjoying the movement of Lisabeth's bright, attentive eyes. Duane looks ready to cry. "This is because of you!" he says. "If you hadn't ignored me, after coming on to me, I never would have done this! None of this would have happened!" Lisabeth shrugs. She's about to reply with a clever remark about causation and fate when there is a rush of air, a blur and a voice demanding, "What's this? What's have you done now?" Amanda stares at Clark. "Where did you come from?" Another weird thing! She huddles close to Lisabeth possessively, remembering how Lisabeth pursued him in the restaurant. He looks at Amanda. "You'd better move away. I have something to settle with Lisabeth." "Clark! You have to help me! They're witches or something. Look what they've done to me!" Duane says begging pathetically. "It's me! Duane Heckshire!" "Duane?" he says. "It can't be!" He looks cautiously at the two girls. Are they witches? When Lana was possessed by a witch she had taken his powers away in a flash. He regained them only by going to the meteorite caves, which were hundreds of miles from here. He can't take any chances, but if he shows any weakness that will be even worse. "Witches? Another one saying that?" Amanda asks, looking up at Lisabeth. Amanda quickly sees that in place of the hungry, aroused state Lisabeth was in last time, she is now distant, even dismissive of Clark, who, Amanda is now at ease enough to notice, is actually very cute. "Lisabeth, please tell me, what's happening?" "Stay away from her or you may get hurt," Clark warns Amanda. "She's dangerous." Lisabeth smiles. "Not to Amanda. But yes, to bullies and rapists like Duane, the 'old' Duane, and people who spy on me, like you. I can be VERY dangerous to people like that." Clark frowns. He doesn't trust Lisabeth at all but Duane could be in the wrong too. The talk around the locker room was that he hadn't been the same since Lisabeth seduced him in the dining center -- seduced him and then abandoned him, just as she seemed to be doing to him. Sure, that was no crime - cruel and hurtful as it was -- but Lisabeth was a killer, not merely a "mean girl". He is sure of that. Lisabeth is so dangerous, now that she seemed to be as strong as -- no, stronger, he had to keep telling himself -- he. And this other girl, Amanda. What is her part in this? Was she involved in the murders too? No, Duane might not be innocent, but something already has happened to him. He needs to get him safely away before he does anything else. He grabs Duane and in a flash he carries him back to campus and leaves him in his room and, after a temporary deprivation of oxygen, asleep. Best if he remembers none of this. "He's gone! Just like he came!" Amanda says, trembling again. "Lisabeth!" she moans, snuggling closer, feeling safe and very, very happy to have Lisabeth all to herself. "Poor Amanda. Too many surprises today?" Amanda nods. "I know. I was in shock when it happened to me, and Clark has given me even more surprises than I ever could have imagined." "Please tell me what happened to you? What's happening now?," she asks, repeating her own question and Clark's and more, as she burrows into Lisabeth's warm, strong body. She wants to know what Lisabeth will say, how much she'll tell her, and how she'll say it. She hides her face against Lisabeth's breast. Lisabeth looks down at the back of Amanda's head and strokes her hair. Dear Amanda. Dear little Amanda! Once she had envied Amanda for her intelligence, her pluck, her willingness to stand up to Jennifer -- the only one she knew who would or could. Now Amanda is cowering, confused and helpless, shrinking away from the world, seeking shelter in her, needing her. She likes that, in a way. It shows how far she has come. But in another way it's disquieting. She is thinking how to explain when there is another rush of air. Clark is back. "We're having this out between us now! If you have any regard for her, you'll get that girl away from here. Or are you using her as a shield?" Amanda turns to face Clark. "Sorry, Amanda. You need to stand back for now. Clark insists, but I won't be long." "Let me watch," Amanda insists. "Of course! I won't be long." She settles Amanda onto the ground and then moves twenty feet away, too quickly for Amanda to see. "So, what's your problem, Clark? I'll tell you what mine is: you're having nothing better to do than watch me with your long distance eyesight and threatening me. I think I have a choice, either give you something better to do, or do something about your eyesight and your ability to make threats. Yes. I know just what to do!" Clark blanches. What will she do next, something horribly destructive, forcing him to spend his time rescuing desperate, helpless people? How cruel could she be? He steels his fists, all ready to fight, when she disappears. Now, where has she gone? He looks around anxiously. Amanda is shaking her head. "This has been the craziest afternoon," she says to Clark in a friendly tone, her hands on her hips. "If I told any of our friends what I've seen in the past hour they would tell me I've been hallucinating. And I have to believe, from what I've seen, that you're not idly staring at the prairie, but instead looking all over for Lisabeth with some kind of super-vision. Is that right? Do you see her?" Clark doesn't answer. "Oh, sure. No one has to tell me anything." Clark shakes his head, unable to find her. "All right. You tell me something and I'll tell you. Did you have anything to do with the murders of Jennifer Conners and Mike Johannson? I warn you. I can easily tell if you're lying." "I bet you can. What are you? A human lie detector?" "Um, not exactly." "It doesn't matter. Of course not! I wouldn't hurt a fly, unless it was trying to bite me, or rape me like Duane was." "OK. You're telling the truth. What about Lisabeth?" Amanda takes a breath and sighs. "I don't know. I don't think so, but I don't know. She's changed lately, quite a lot. But she's a good friend, with a good heart." "I don't know if I can accept that. I have good reason to believe she is the one who killed Jennifer, brutally." "Why? Why would you think such a thing? No one else has said so." "I found some of Lisabeth's -- Chloe!" Lisabeth has appeared with Chloe completely limp in Lisabeth's arms, her body reflecting the bright light shining from Lisabeth's eyes. Her clothes are different, much more elegant than her usual garb. They hang on her torso, the sleeves are far too long and the skirt is below her knees. Clark rushes toward her, but Lisabeth holds her hand up. "Stay where you are, stay right there. I won't hurt or harm her, not a hair on her head, but I won't be responsible if you blunder into me and start something. She's a lot more fragile than I am." She smiles. "Anyway, I'm almost finished. I want you to see this, Clark." Lisabeth looks at Chloe and bathes her again in the strange white light. Chloe moans softly, musically. Her hair deepens to a rich honey blonde. Her cheekbones become more prominent and the shape of her face becomes rounder, as do her eyes, while her nose and chin soften. Her arms and legs grow longer, more toned, her skin finer, and her bust develops and then develops some more, taking up all the slack in her blouse and then stretching it. Lisabeth puts her down and twirls her as in a dance so that her skirt swirls out and settles where it shows most of her long, elegant thigh. She is still recognizably Chloe, but a stunning, magnificent Chloe. Clark stares at her, speechless, while Amanda looks at her with more than a little envy. She opens her eyes, blinking them slowly, as though batting her eyes at Clark. "Clark," she says, her voice singing like a cello, the sound startling her. She tries again. "Clark, what's happened ...." she stops again, but quickly realizes the beauty of the full throated sounds she is making instead of her normal nasal screech. "... to me?" she concludes, her voice even lower, richer, sexier, as though she has already begun to master its new power. She looks down. Her mouth opens in a glorious circle of amazement as she sees the way her large, round breasts push the outline of her blouse far forward and the way her long, slender fingers slide through the air. She takes half a step and looks down at the flawless skin of her leg and then over at Clark who continues to stare at her, wordlessly, helplessly, hopelessly in thrall to her sudden beauty. A warm glow suffuses her. He has never looked at her like that before. She takes a full step toward him and then another, enjoying the easy grace with which her body as a whole advances toward him while its parts swivel and bounce and turn. She realizes she is nearly as tall as he is, just an inch or so shy, and pauses. She puts one hand on her hip, feeling the long curve it makes as it slants up to her wasplike waist. "I'm so different, Clark. Is something wrong?" "You've changed ... so much," he says, his voice dry. He coughs, clearing it. "I mean ..." he glances at Lisabeth and then looks back at Chloe, unable to stop looking at Chloe. "You have no right ... Lisabeth ... to do this. No ... right," he repeats, his voice soft and not at all convincing. He has important things to do, he knows, but this gorgeous creature, not just gorgeous, but loyal, true, more virtuous than he in every way, and now so beautiful, beyond words, beyond all his dreams. "No, she didn't," Chloe agrees, her voice a melody, "but, Clark, I like it." She extends her arm to him, marveling at how each move she makes captures his full attention. She knows it's wrong somehow, but she's not sure why or how. If Lisabeth had asked her for permission to change her like this, she would have said no, but she didn't ask and Chloe is beyond grateful, to have him want her as she has always wished he would. All other concerns pale beside this fulfilment of her dream. Clark can't take his eyes off Chloe, and she, hardly able to believe it, keeps finding new ways to twist and turn her ultra-flexible and curvy body to cement his attention. "You've made her so sexy that he can't think of anything else," Amanda remarks, clearly a bit miffed. "And that's bad because ...." Lisabeth replies, hooking her arm around Amanda and pulling her gently against her breast. "He wouldn't be for you anyway. Not because there's anything wrong with you, but, believe me, there's a lot of history with him and other girls. I've checked him out. He has a real problem with commitment, honesty ... and sharing." "And what about you? There's obviously something YOU'RE not sharing with me." Lisabeth bends over and kisses Amanda full on the lips and then supports her when her knees begin to wobble. "Dear Amanda," she murmurs in her sexy voice. "Let's leave them. I'll tell you everything you want to know, if you want to talk." [NO] [Shut up. It's time for me to do this.] Amanda clings to her tightly and Lisabeth lifts her, covers her protectively and in seconds they are back in her room. And they talk. And talk. 32 Many hours have passed. Lisabeth is on her side across her bed, while Amanda sits cross-legged with her back against Lisabeth's thigh. "So you've got Missy's sexiness, Jock's athleticism, Duane's muscle, Jake's brains plus you can run faster than airplanes, see through walls, pull trees out of the ground and throw them into orbit? And you get this way by copying the genes of other people?" "That's right. It started with you, Amanda, when I kissed you the afternoon you were doing my makeup. I'd had this urge to get Jock's, um, genetic material when I was in gym with you. Kissing you, which is another way to do it, doesn't give me as much to work with as a guy's cum, but it's the only practical way to get genes from other women. But that made me smarter, cleverer too, I think and improved my eyesight." "Yeah, that's me. Clever with good eyes. But I'm not much good at busting through walls. "Yeah, I get that. That was from Clark's genes. Combined with the capabilities I gained even before I acquired his abilities, the enhancements he has given me have propelled me far beyond him, and he can't absorb traits from other people like I can, and he can't change other people. And I keep getting new abilities. Something inside me keeps manipulating my genes, improving me. Like I can fly. He can't." [Author's note: This story takes off from the plot line of the television show "Smallville" in which Clark has not developed or learned to used his flying power.] Lisabeth leaves out the part about the voice of ABX inside her. Amanda is tracing her fingers around Lisabeth's breast. "But Lisabeth, he said you killed Jennifer. And Mike. Is that true?" She looks up at Lisabeth's face, into her dazzling eyes, wondering what may emerge from those eyes. Her fingers continue their soft motions as she waits for the reply. If she is Lisabeth she won't hurt me, she thinks, but if she is Lisabeth could she have killed the others? Am I brave or foolish, Amanda wonders? Probably both. But I can't help being curious, and I love hearing her voice. "I did. I did. I had to." Lisabeth lay still, knowing she was being judged. Amanda nods, struggling to reconcile her feelings for her friend with the awful knowledge that she had killed Jennifer. Right now she was intoxicated with Lisabeth, but even apart from that, she loved her as a friend, and with all the changes Lisabeth had been through, she looked into Lisabeth's eyes and still saw that friend. There was no higher value she needed to answer to. Besides, Jennifer was dead. There was nothing she could do for her now. "What else? What else did you do?" "Nothing like that. You saw Duane." "Yeah. Anyone else?" Lisabeth laughs. "Remember Missy?" "Missy Marshall? Oh my god! It was YOU who made her so ... so GROSS?" Lisabeth nods. "Fat. Smelly. Hardly able to walk?" "Yes ... well. It wasn't" She can't say it wasn't her idea. She can't tell Amanda whose idea it was. "The others ... well, that's history, and Duane deserves to see life from the other side, Lisabeth, but Missy? Sure, she was shallow, stuck up, superior, annoying and too beautiful to bear. But she never did anything especially unkind to you or to any of us, did she? Does she deserve what you've done to her?" Lisabeth remembers the slight she felt when Missy withdrew from her, but, with her suddenly perfect recollection, realizes Missy wasn't rejecting her -- she was just afraid. Sympathy washes through her. [DON'T] [Shut up. It WAS wrong of me.] [IT WAS NECESSARY] [You are inhuman, you know?] [WE ARE MORE THAN HUMAN] [No. LESS than human.] "What is it, Lisabeth? What happens to you, when you just seem to vanish suddenly?" "It's nothing. Nothing. Really." She sits up. "Let's find Missy. I can fix what I've done." "Really?" Amanda takes her hand. "I love you, Lisabeth." [DON'T WE MUST NOT] [It was wrong] [IT WAS NECESSARY] [It was not] [YOU MUST NOT. WE ARE THERE TOO. THERE ARE THINGS WE ... YOU DON'T UNDERSTAND] [You! This is a first. You always speak of WE] [WE UNDERSTAND] [I'm driving] "Lisabeth!" "I'm here, Amanda. I'm here. I love you too! Let's go." They walk quickly together to Missy's room, Amanda taking three skipping steps with extra catch-ups to each of Lisabeth's two. "You're not bad, Lisabeth. You aren't. I know that, and I told Clark that," she says breathlessly, marveling at the good Lisabeth would do. Her power. Her beauty. Their friendship and now so much more. Everything is possible, so much more than she had ever imagined. There are things in the universe that are more wonderful than she had imagined, than anyone would ever believe. She hooks her arm inside Lisabeth's, proud to be with her. Lisabeth sounds a low, satisfied chuckle. This is new. Amanda is not afraid of being seen with her. She is so special. She knows that she has always loved her. Then Lisabeth's arm stiffens painfully against Amanda's, who cries out. "Crystal sees us! Crystal!" Lisabeth says simply, watching her run away in tears. They stop momentarily. "Do you ... want to go to ... her?" Amanda asks. "Everything. I want everything," Lisabeth says plaintively, now unsure of herself. "I've hurt her. But no. I want you!" [WE TAKE WHAT WE WANT. WE HAVE NO OBLIGATIONS] [My friends. My life. I can't ignore obligations.] [JENNIFER REJECTED THEM. WE ARE BEYOND THAT. FROM HER WE WENT BEYOND...] [You! You tried to change me.] [WE ARE CHANGING OPTIMIZING ALL THE TIME] [You tried to make me like Jennifer -- heartless, manipulative, cold] "Lisabeth! Lisabeth!" Amanda was calling. "Where are you? What's happening?" [COMPENSATING. FILTERING. OPTIMIZING] ABXCCTKYTNNCCGTTACA ... [Stop! Stop! I'm the one driving!] [I AM THE ENGINE] [You can't make me. I won't let you] [OPTIMIZING] TTCAGGATNOOPTGPPKCGGAT ... [No!] [No!] [LISABETH IS MORE THAN MATERIAL. LISABETH CANNOT BE WHOLLY OPTIMISED. LISABETH MUST LEARN TO CHANGE] [Ha! I am Lisabeth! YOU will learn!] [WE ARE LISABETH. BEING SUB-OPTIMAL IS ... OUR LOSS] [We'll see!] Lisabeth won't wait until it tries to change her again. She lifts Amanda and in half a second they are at Missy's door. She knocks and then when there is no answer pushes it open. The room stinks. Missy is sitting in a pile of candy wrappers, pizza boxes, bags of potato chips and beer cans. She is half dressed. Her large, round, soft stomach juts out of the bottom of her t-shirt and hangs over her panties, while her floppy breasts stretch out the top, compressed to the sides of her chest. She belches and looks up at Lisabeth and Amanda, annoyed at the intrusion. She brushes her greasy hair away from her oily forehead apathetically. "You! What are YOU doing here?" "Missy. Missy, I am so sorry." "Sorry? What do you have to ... if I'd known that after kissing a girl I'd soon be ugly and disgusting .... Funny thing ... I liked it." She looks Lisabeth over. "Doesn't look like it hurts you much. Maybe I was right to be afraid." She farts loudly. "Can't help it. Can't help anything. So I just do it." She laughs bitterly. [WE MUST GET OUT. BEFORE IT IS TOO LATE AND YOU WILL LEARN. GET OUT BEFORE YOU LEARN] "I can help," Lisabeth says. "You?" Lisabeth stares at Missy. [Something strange. Different.] [WE MUST NOT] [I must] The white light bursts from Lisabeth's eyes and bathes Missy in a white glow and then she shines brilliantly. Lisabeth staggers slightly. The light grows more intense. Amanda covers her eyes. "Lisabeth! What's happening?" Amanda says. "I can't see." "Can't ... stop ...." Lisabeth says. "There is something more ...." [WE ARE THERE TOO. THE OFFSHOOT ... BUT NOW ... JOINED. THE SAME. WE ARE LISABETH. WE ARE MISSY.] "OOHH!" Lisabeth says, waving her arms unbalanced until the light disappears and she covers them with her hand. In a few seconds she regains her composure and looks at Missy searchingly. Missy ignores her, her eyes lost, in another world. Amanda runs to Lisabeth and holds her. "Are you all right?" she asks. Lisabeth nods and bends over slightly to Amanda. "I'm fine. Fine." "You look the same. The same as before." Amanda turns to Missy. "So does she. It didn't work on her the way it did on Duane." Missy locks her eyes on the two others and growls, "Get out. Get out of here. I don't need you." "OK. OK." Lisabeth says. "I'm sorry." Missy glares at her. "Go away! Just go." She turns her back on them and folds her arms over her chest, trembling. The fat in her upper arms ripples like shaking jello. Lisabeth looks down at Amanda, shrugs, and motions to leave. They slip out quietly, touching. Missy hears the door lock catch and then walks to the window. She looks at the dark curtains for a moment and wrinkles her face in annoyance. She throws them open, spreading her fat arms across the frame, while the sun beats on her round, exposed stomach. She shivers. Something quivers inside her arm and her stomach, making the fat vibrate, but she shakes her head firmly, and it stops. She stands nearly motionless, her eyes closed against the sun for six hours, turning slightly only to follow it through the sky, blind to the derisive stares from the students passing by, deaf to the jeers deriding the fat girl displaying her ugliness for all to see. The sun sets. Missy's eyes open. It's dinner time. 33 Yes, dinner time. Missy walks in to the Student Dining Center by herself, her presence barely registering on the crowd as bread rolls fly, loud conversation rises and falls, tables are pushed together and pushed apart, bodies squeeze in and squeeze out. Two freshmen boys in front of her in the line screw up their eyes at her beachball-sized bottom and the pouch of fat that hangs over her pants and move as far away when they detect the strangely disgusting odor that descends suddenly around them. She moves closer and stretches, raising her arms high in the air, which unleashes even a stronger odor beneath her arms and reveals even more of her bulging stomach. The murmuring around her grows louder. "Doesn’t she KNOW?" "Disgusting." "There ARE showers in EVERY dorm, you know." "This shouldn't be ALLOWED." "Must be some kind of HEALTH risk." "ESPECIALLY in the Dining Centre." She moves though the line, oblivious to the remarks, heaping her tray with macaroni and cheese, multiple glasses of coke and chocolate milk, chocolate cake and chocolate muffins. She emerges from the food line and surveys the rows of tables, impressively balancing the food laden tray, then hears a voice among the crowd and launches herself toward it, her gyrating, wide bottom occasionally brushing against her fellow students and pushing their chairs along while she ignores their cries of annoyance and disgust. She sits down, finally, in an empty chair next to Tina. Her flesh spills sideways, massing against her neighbor. There is no room for Tina to move more than two inches away. "Do you MIND?" Tina says with an angry look. "If you don't fit in at a table you should find another place!" Missy shovels several forkfulls into her mouth and burps contentedly. "You are SO gross, Missy! Do you have ANY idea what you LOOK like?" Missy continues eating quickly and has almost finished her main course. Some of the other girls at the table begin to get up, unable to stomach her odor or watch her eat. Tina starts to stand up, but Missy puts her arm around her and holds her down. She lifts her foot and shoves the table backwards, pinning it and the girls behind it against the wall. "Nobody leaves until I'm done!" she says firmly, her eyes suddenly steely. She looks to her left and right, down the table. "Understood?" The hint of her old authority surprisingly conquers the girls. Missy smiles and continues eating. The other girls watch, trying to ignore the smell. "You're hurting me," Tina complains, as Missy's arm lays hard on her neck. Missy ignores her. "Please, Missy," she whines. "Is my arm too heavy for your slim neck, Tina? Kiss me, and I'll let you go." She puckers her lips, stained with the cheese sauce of her macaroni. A few of the girls say, "Ewww!" "Missy!" Tina whines. "I promise," Missy says. "One kiss and you're free." Tina trembles and then leans over and pecks on Missy's cheek. She looks at her hopefully. "Uh uh. On the mouth!" Missy waits, her lips primed. Tina looks pained. Missy squeezes her neck. She nods. "OK! I can't believe you've gone 'GAY' too!" At that word, Crystal, sitting by herself behind Missy, sniffling, turns around and watches. Tina kisses Missy, intending another brief peck, but she can't bring herself to let it go. The taste of her mouth is utterly unlike her odor. It is honey, ambrosia, the nectar of the gods. My goodness! Is she cumming? The kiss goes on and on. The girls quiet around them, watching curiously, until Missy herself breaks it off and withdraws her arm. [NOTHING WE NEED] [From Tina? Of COURSE not!] "You're free, Tina." Tina has not moved. She opens her eyes slowly and stares at Missy. Her lips quiver. "I ... I" "You want something, Tina?" Missy daintily wipes her lips. The odor at the table has lifted, and honeyed sweetness has descended to take its place. The girls feel prickly, excited, flushed. They shift in their seats uncomfortably, nipples hardening, blood pulsing. They look at each other, confused and embarrassed. Is it obvious? Is it their private scent? Can anyone tell? They look at Missy, who sits contentedly watching, no longer eating, her lips pursed prettily. She stands up lazily and takes a brush from her purse and starts on her hair, each wave of the brush takes out tangled, mottled curls and leaves the strand of hair, straight, blond and lustrous. Her hair done, she shakes it out, and pulls her t-shirt down over her large breasts and then pulls at a drawstring she had expertly sewn into it at the bottom, making it tight over her narrow waist. She does the same with her shorts, the excess fabric on each side gathers in neat folds at her hips, and secures it with a neat bow. "That's better. Don't you think so?" She turns quickly, side to side half- turns and then sits down. The girls are staring. That's Missy? Even more beautiful than the old Missy. But what happened to the fat, ugly Missy who sat down with them? Crystal has turned around in her chair, her eyes rapt. "You're ... you're beautiful again, Missy?" Tina says in awe. "More." "I am," she says. "Better than ever." She turns and looks at Tina. There's a flash of light as though someone has snapped a picture. Heads turn looking for it. "Oooohhh!" Tina says, laying her head down on the table, suddenly feeling faint. When she lifts her head she can only see the chocolate on Missy's plate. She grabs it and begins stuffing it into her mouth. "I get ... so hungry ... need to -- "You want my dessert, Tina? Go right ahead and eat. If you need to. Oh, but it looks like you're getting a pimple on that little nose of yours already. Chocolate won't be the best thing." Tina shakes her head. "No. But I ... so hungry for ...." "Your salad?" Tina scrunches her eyes and shakes her head. "May I? We can switch trays." Tina nods desperately and begins wolfing down the remains of Missy's macaroni, hunching over Missy's food, while Missy delicately chews on Tina's greens. She stands up. "I've had enough. Any of you want to take a walk with me?" She pulls the table back one-handedly, freeing the others. Several of the girls rise with her, including Crystal. "Can we, Missy?" They look longingly at their unfinished dinners, but to be part of Missy's group is far more important. She doesn't answer, but doesn't say no. She leaves her tray at the table and the girls follow, except for Tina, who is nearly finished with Missy's tray and starts stealing the sweets off the abandoned trays of the others. Missy walks through the room, now followed by the eyes of every male and three-quarters of the females in the room. Mary Elizabeth shyly joins them, working her way through the crowd until she almost reaches Missy, who stops at one table. Jock, Bud and Carlos had been wolfing down their usual but have stopped to look at Missy, while Duane sits hunched over, his thin arms hidden under the table, swimming in his clothes. "Duane," Missy says, her sexy voice massaging them. "Duane, stand up." Embarrassed, he rises slowly, his stick thin body a shocking contrast to her voluptuousness. "Awww, did SHE do that to you? That girl has no school spirit. What are we going to do about Nebraska Saturday without the old Duane?" Her eyes twinkle. "I think our whole team needs a little pick-me-up!" She looks at Duane and he is suddenly bathed in a white glow. His muscles begin to thicken, his shoulders broaden and his chest deepens. There is a murmur at the table. He looks nearly as large as before and then, in a sudden burst, his muscles bulge and harden until he is much stronger than he ever was and several inches taller. Missy's eyes sweep across the table and as they rest on each athlete, he glows briefly and his muscles grow and harden. "There! I think we have a GREAT chance now! What do you think, girls?" They all nod enthusiastically. "Oh, it's perfect!" one of them squeals. Missy looks more closely at Mary Elizabeth. "Duane'll kill them all!" Missy smiles. She leans over at Duane and whispers in his ear. He licks his lips and stands up. He is nearly seven feet tall. His legs have burst through his pant legs while his chest muscles stretch out his t-shirt. "It's my old friend Mary Elizabeth!" She beams with the recognition of her status and moves forward. "Mary Elizabeth," says, hooking her arm around hers. "Duane's had a hard day. I want you to help him relax before the big game. You know what I mean?" Duane excitedly rubs his crotch, the huge bulge evident to all. Mary Elizabeth looks shocked. She stammers, "B-but Missy. I ... I'm, you know, still a virg ... I mean, can't I stay with you?" "I know you've missed me terribly, Mary Elizabeth, but Duane needs a woman to run through a few moves together, and I know you're just the girl to help him. He'll have a lot of aggression coming into the big game, so don't expect him to be gentle, but I'm sure he has a lot to show you. A LOT to show you. Duane," she says, running her fingers down his chest to his crotch, "Mary Elizabeth here doesn't have any experience; she doesn't know what's good for her, or what she likes. She'll just have to be taught. And don't forget, Mary Elizabeth is a woman, so 'no' means 'yes', 'maybe' means 'yes'. And do you know what 'yes' means?" Duane shakes his head. "It means, "yes," Duane." She takes Mary Elizabeth's arm and pulls him into Duane. The thin, terrified girl nearly disappears into Duane's enormous chest, her head barely reaches his pectorals. He places one meaty hand around her waist. "C'mon M.E. I know you want it!" He half carries her and half drags her away. "Old friends," Missy sighs. "I prefer my new friends," she says, looking at the girls around her. "And just one thing, my 'new' friends can call me Mixxy." 34 It is Thursday evening. Missy and her new friends are in Starbucks. Marlena has brought Missy her second three-quarters skinny latté, extra foamy, with a shot of liquorice. The first was too sweet, and Marlena has tried three different versions of the second to make sure it meets Missy's approval. Robyn Saffron and Crystal are sitting with their drinks, but are waiting for Missy's to arrive before they start, waiting unhappily because theirs are getting cold and their froth is rapidly subsiding into the coffee. "You are just too beautiful, Missy -- I mean Mixxy. I don't know how you DO it!" "It's genetic, partly, Robyn, but it's also a matter of will. A girl isn't just beautiful, she has to BE beautiful." Saffron is nodding enthusiastically. "I know! Because, you know, there are a couple of other girls who kind of look like you, but they're NOT you, and that makes all the difference." Missy turns to her, looking annoyed. "Don't be ridiculous, Saffron. No one looks like Mixxy! No one could!" Crystal puts her hand on Missy's to show her solidarity. Missy shakes it off. "Two girls? I know all about your friend, Lisabeth Collins," she says, her disdain too hot to be as cold as she wished to show. She turns to Saffron. "Who exactly is the other?" "N-n-no one, Missy ... MIXXY!" Saffron stammers. "I know it's not possible that..." Missy takes Safron's hand and rubs it lightly with the tips of her fingers; at the same time she compresses the napkin dispenser on the table with her thumb and forefinger. "I'm sure I know much more about what's possible than you do Saffron. Hmmm? Why don't you just tell me all about the second one?" Saffron smiles accommodatingly. "Um, er, she's not a student here. But I've seen her a few times with a guy. I think his name is ... yeah, Clark. She's very, uh, pretty. He's not bad either, but he's just completely taken with -- where are you going?" They all stand up. "No. Wait for me here!" She angrily pushes the door open and knocks part of it off its hinge. [How DARE she!] [WE WORK WITH THE TOOLS WE HAVE] [I will NOT be USED by her] [WE OPTIMISE USING THE BEST MATERIALS] [I don't CARE. This is WAR.] [WE KNOW IT IS] [I'll find her. Just WAIT until I find her!] Missy scans the campus quickly for her double and then breaks into a run, heedless of the quick destruction of her shoes and of the whirlwind she creates throwing aside the students in her path. She arrives at Clark's room seconds later, not even winded, shakes her hair back into shape and knocks loudly at the door. Inside, she hears embarrassed scrambling and whispers. "Who could that be?" "I don't know." "Maybe they'll go -- "I'm NOT leaving!" Missy announces. "Open it up NOW!" She knocks harder, only her iron will stops her from breaking through the door ... yet. Still, the indentations her knuckles make on the metal door are a nicely satisfying substitute. There is a series of clicks and turns, and Clark appears, looking disheveled, blocking the way inside. Missy squeezes by him. The girl, even more dishevelled, is quickly buttoning her shirt. "Don't bother. I've seen it all before," Missy says tartly, taking in the full extent of their resemblance. "The nose isn't right, and you'd have a LOT to learn about how to brush your hair. But there's really no point your learning. Even if you were a quick study, which I seriously doubt, you won't have much time to practice." Clark grabs Missy's arm and spins her around. "Hey! What exactly do you think you're doing?" Missy yanks her arm free, throwing him off-balance. "So I guess you're the one we get it from. I wouldn't have thought you were Lisabeth's type -- or that she was yours. Not that it matters to me, although I bet you feel much the same as I do about having your genes stolen. The thing is, unlike me, there's nothing you can do about it." "Clark," Chloe says, taking it all in quickly. "She looks just like Lisabeth. Does she have your powers too?" Missy turns to her, exasperated. "Let's get something clear, Clonie. It's you and Lisabeth who look like ME." "That's 'Chloe'," she says, unnecessarily. "Oh really? Not that it matters." Missy puts her hands on her hips and looks Chloe up and down. She then glances at a picture of Chloe in a byline from the Smallville high school paper and laughs. "I've got all your genetic data stored in my marvellously brilliant new brain, but I'm just wondering whether it will be punishment enough simply to put you back the way you were before." Clark speedily interposes himself between Missy and Chloe. "Don't blame her. She had nothing to do with it." "Ooooh! Well, that got a STRONG reaction! Share how THAT makes you feel, Chloe. He likes you only because you look like ME!" Clark blushes and looks down, too embarrassed to look Chloe in the eye. "It's not true, Chloe!" he says unconvincingly. "Isn't that just like a man! But Clark, unless you want to end up looking just like Chloe too, and being every bit as 'powerful' as she is, I suggest you move away smartly." "You're bluffing. You can't do anything to me!" "Can't I?" [I can, right?] [WE ARE NOT SURE. WE HAVE NEVER TRIED.] [Well, he IS Lisabeth's enemy, so he may be useful as he is. For now.] "Y-you'd better do as she says, Clark. I've lived my whole life in my, you know, usual skin. It's nothing, really. At least ... for one day ... I had -- "This is so-o-o-o touching. So brave, self-sacrificing and noble. I can hardly stand it. Is this how you people make up for looking so ... ordinary?" Her eyes flash and bathe Chloe in bright light. Chloe collapses on the ground, her features revert to their plainer form, while Clark stands aside, his fists clenched helplessly. "Good. One down, one to go! And then, I'll be the only one who's, heh, heh, me!" Chloe's eyes open. One look at Clark tells her the spell she held on him is broken, and a tear rolls down her cheek. He helps her up and the two of them stand together facing Missy. "I think I'll go and leave you to talk. Tough luck, Chlonee. It looks like you won't be going back to whatever you WERE doing before!" And she disappears. 35 It is nearly seven-thirty. Lisabeth and Amanda are in Lisabeth's room, intimately entwined, when there is a loud pounding on the door. "Lisabeth! Lisabeth! Are you there? Damn it! Where ARE they?" "Valerie!" Lisabeth whispers in Amanda's ear. "We've got to find them!" "Vrema," Amanda whispers back. "I told you they wouldn't answer!" "But they HAVE to!" Valerie says, pounding harder. "Just say something, if you're in there!" Lisabeth and Amanda sigh and look at each other. Lisabeth nods, and an instant later both are dressed and standing. Amanda wobbles but Lisabeth catches her. Amanda shakes her head in amazement. Lisabeth is already opening the door. "We were just talking," she lies. "You won't believe this. It was the most amazing thing!" Valerie says. "You know Missy, how ugly and gross she got? She was at dinner, sitting with people again, instead of alone at a table with piles and piles of food, like she's been eating lately, and suddenly the next thing you knew she was more beautiful than ever before! She just transformed!" Lisabeth looks concerned. It shouldn't have happened so quickly. "I don't understand," she says hesitantly. "What's to understand? She sat down fat and stood up gorgeous again. And that's just the beginning. She goes up to Jock's table. There's the four of them, as usual, except that Duane isn't at all like Duane. He's all weedy, like, like, Jake Toefel." Amanda looks at Lisabeth. "But then seconds later he is as big as he was before, and then even bigger. Tons bigger. And then so are the rest of them. They're all giants." "What do you mean, giants?" Amanda asks. "Like, fifty feet tall or something?" She laughs. "No," says Vrema. "That would be an exaggeration. Duane is nearly seven feet tall, and the others three or four inches smaller than he is." "See? You know how Vrema is so good at those things." "Everybody's talking about it!" Valerie exclaims. "We thought you should know," Vrema says. [She has Clark's powers too? She's like me now.] [EXACTLY. EXCEPT WHERE SHE IS DIFFERENT. WE ARE THE SAME, BUT YOU ARE NOT MISSY.] [What do you mean? Of course I'm not Missy.] [NO. WE ARE LIKE MISSY.] [We are ... what do you mean 'we'? We -- you and I? -- Or we ... I don't know] [THESE THOUGHTS HAVE NO WORDS] ['We' means you. You and the you in Missy. You're all the same. I'm the one who's different.] [MISSY UNDERSTAND WE] [No! I understand!] [WE ARE LIKE MISSY, MISSY LIKE WE ARE] "Lisabeth! Lisabeth!" Amanda is shaking her. Valerie and Vrema watch helplessly. "She keeps doing this," Amanda explains. Lisabeth comes back to life. She scans the campus quickly. "She's in Starbucks! Guys, I have to go!" She runs down the hall and opens the door. Amanda calls out, "Wait! Wait!" But she has vanished. "Where did she go?" Valerie asks, more mystified than ever. "Come on. We've got to get to Starbucks. She may need our help!" Amanda says, pulling Vreme and Valerie with her. And Clark is on his way too. 36 Missy is sipping on her drink, the eighth version. "This one is just right, Marlena. Do you think you'll remember now how I like it?" Marlena nods, trying desperately to recall exactly which variation she had just received. Was it less skim milk or more? An extra shot of espresso, or an extra two shots? Or was this the version with a quarter squirt of chocolate syrup? Missy glances from girl to girl, thinking about how she'll change them so that they'll complement her more perfectly. Marlena has a nice shape. A larger bust will gather more attention, initially to her, of course, but being slightly out of proportion with her hips will make Missy's own perfect ratio even more pleasing. Saffron's dark hair is perfect and slightly fuller eyebrows will be more striking and will highlight Missy's full blond hair. Robyn's glasses will HAVE to go. Her eyesight will be easy to fix, but she will also need more muscle tone so she can keep up better. And Crystal, cute little Crystal. Is it as obvious to everyone else how much of a crush Crystal has on her? Nothing wrong with a little unrequited adoration, but if Crystal is not simply cute, but instead spectacularly gorgeous, well, what will that say about Missy! Knockout Lesbians are very much the rage now. So much to do! "Missy! What the hell are you're doing?" Lisabeth asks angrily as she enters Starbucks and pushes her way to Missy's table. "Crystal!" She looks at her in amazement. Crystal turns red and turns away, embarrassed, but then looks back. The girls look confused. Should they protect Missy or stand aside and let her handle it? Missy looks up. "Well, well, it seems that the little lesbian has grown up. Where DID you get that hair? And those breasts? Maybe you think I SHOULD be flattered ... but I'm not. What do you think, girls? Is imitation the sincerest compliment, or is it just a lack of natural talent ... or imagination?" Missy's words sting and Lisabeth's face reddens. "God! Her mouth is EXACTLY the same! The doctor must have been pretty good -- no scars -- but it's so weird that she'd do that," says Marlena, before recovering, "um, but not weird that she'd WANT to, you know." "At least her blush is natural," Saffron tittered. "Now we know what Mixxy would be like with man muscles. Like, never!" Robyn says. Crystal just looks from one to the other, back and forth, her lips red and her mouth forming a perfect "O". Lisabeth realizes for the first time the extent of the resemblance. "Missy ..." she starts. "WE call her Mixxy!" Saffron says in a superior tone. Lisabeth ignores her. "Missy, I ... I'm sorry if I offended you. I wasn't trying to ...." Lisabeth's voice trails off. Their eyes lock. "You hurt me ... before. When you left me." "You were using me, weren't you? Like you are now." Missy says, surprised by the confession. "Yes. No! I wanted you, really." Missy nearly replies, 'who doesn't?' but something stops her. Is it Lisabeth's surprising honesty about her feelings? Or maybe the resemblance to herself mixed with Lisabeth's residual traits and her height and muscle has some appeal. Still ... there is Lisabeth's power to consider. It's a clear threat to her own supremacy. She could like Lisabeth better if she knew she would be the one in control. The door opens suddenly in a rush of wind and someone new appears at the table. "The two of you! Together?" It is Clark. "Now listen to me. I don't know how or where you've gained your special meteor powers, but powers like yours must be used responsibly or not at all. Your misuse of your abilities is going to end. Right here. Right now!" "Meteor powers?" Crystal says, her eyes wide as she looks carefully at Missy and Lisabeth. She licks her lips. "What are those?" Lisabeth looks down at him disdainfully. "I can't believe this, Clarkie. Are you really THIS fickle? Don't tell me you're tired of Chloe already?" "Oh, I took care that clone!" replies Missy. "She's not not herself anymore," she sneers. Lisabeth whirls around at Missy. "You WHAT? That was supposed to keep HIM busy and out of my hair!" "Not with MY body!" "It wasn't YOUR body. It was hers, tailored for HIM!" "It was close enough!" The eyes of each girl in Missy's new retinue are bouncing back and forth between their idol and Lisabeth and then to the handsome Clark. Being Mixxy's friend is so exciting! Clark folds his arms across his chest, pleased that even though Lisabeth and the other girl looked as though they could be sisters, they clearly were not allies. The other girl did not look as strong as Lisabeth, but he would still have to be cautious. Still, if they were fighting each other too it would make it much easier for him to defeat them both, and then find a way to remove their powers. He would have to play this exactly right. "She can't be trusted, can she," he says. "No she can't!" Missy says. "Not as long as she can make clones of me." "Not as long as she selfishly interferes with ME!" Lisabeth replies. The two girls glare at each other, their hands on their hips. Clark grins expectantly. The white light blazes out of Missy's eyes first, followed by Lisabeth. They groan and stagger but can't stop. The beams meet in the middle, the light bursting into a rainbow of colors where they collide. [Take away] [No more power] [IT WON'T] [WORK] [Harder] [More] {WE ARE] [ONE] [NOT TWO WHEN] [CONNECTED MUST BE] [MUST BE CONNECTED] [Pervert] [Bitch] [Freak] [CONNECTED] [CONNECTED] [Oooooooooh lovely] [Aaaaaaaaaaaaaah delicious] [LIKE BEGINNING] [Sister] [Sister] [ONENESS] Their eyes half close and they seem to relax; the beams are more focused but start shifting in intensity. "Look at them!" Saffron says. "What's going on?" Robyn asks. "It's not good!" Marlena says. "She's hurting Mixxy!" "They're hurting each other!" Crystal says, and runs between them to stop them. "No!" Clark says, grabbing her waist to prevent her from getting in the path of the beams. "Let me go!" she yells. "Let me GO!", she says even more loudly and slaps him. "Owwww!" she screams as her hand slams into his steel-hard cheek. Distracted, Missy and Lisabeth turn to see what is happening. The connection of the beams is broken; instead, they converge on Clark. [Still a threat] [So annoying!] [Take them away] [No more power] "Hey! Stop!" he cries, holding his hands up against the white beams. [Take them all away] [OH YES] [No more] [Can't be trusted] [Won't need to be] [OH YES] "Done!" Missy says out loud, her eyes open, shining blue. "All done!" Lisabeth concurs. Clark looks from Missy to Lisabeth, suddenly uncertain at the shift in the mood. Lisabeth winks at Crystal, who slowly begins to smile through her tears and glances at Missy, who nods. "Let me see that hand, Cryssie." Crystal shows her the hand and Lisabeth kisses it in several places. "There, there, all better. It wasn't broken. Why don't you try it out? On that nasty boy over there." Crystal giggles. "But I'm not angry anymore." "Do it, Crystal," Missy urges. "For me." "For us!" Lisabeth says. Are you sure?" she asks. Lisabeth and Missy nod. "Well ... if you BOTH say so!" "Hey, come on!" Clark protests. "She's going to get hurt again." He holds her by the shoulder, keeping her at arms length. "Don't you TOUCH me!" she says in her high-pitched girlish voice. She struggles unsuccessfully to get free, and then digs her nails into his hand. "Ouch!" he says, dots of blood appearing on his skin. His eyes grow wider. Crystal seizes the opportunity and slaps him hard, turning his head. "Hey!" he exclaims, shocked at the pain, his skin reddening. He looks furious and turns to her, hands clenched. "Nice, Cryssie!" Lisabeth says. She squeals and runs back to them, standing between Lisabeth and Missy, holding their hands, feeling safe and happily secure. Clark is about to follow but then hesitates and stays where he is. They have powers. And now, he doesn't. Crystal sticks out her tongue at him and wiggles her hips to say "nyah-nyah". The door opens, and Chloe rushes in, followed closely by Amanda and Vrema. Valerie, red-faced and out of breath, is a block behind them. "What's happening?" Amanda says. "You missed it! It was great!" Crystal says, tightening her grip on both Missy and Lisabeth. "And now everybody's friends!" "Clark!" Chloe says, instantly seeing the blood on his hand and his blotchy face. "Except him!" Crystal adds. She rotates her hips again for emphasis. "Chloe!" Clark says. "They've taken my ... I mean, I'm not ... special. We've got to go to the caves. Maybe there Jor-El can ...." Chloe looks at him, then at Lisabeth and Missy. She sees her plain features in the glass window and then looks back at Clark. She sets her jaw firmly and whirls her arm around, slapping him in the face. He spins and falls. "You can fucking go there by yourSELF!" She storms out. The girls look shocked for a moment, and then laugh. Missy looks at Marlena. A brief flash of light and her 36C bra is woefully undersized. Lisabeth assists with a burst of heat vision, severing the bra straps and freeing Marlena's bust. "Thanks!" Missy says. Lisabeth winks. Valerie makes it through the door and collapses on a chair, breathing hard. "What was the rush? Where are -- Lisabeth looks at her, thinks a moment and then bathes her in light. When she stops, Valerie's figure has gone from 32-35-36 to 35-22-35 and she rises refreshed and full of energy. "Hey!" Missy adds some blond highlights. "Nice touch!" Lisabeth says. Missy blows her a kiss and then quickly fixes Robyn's eyes and Saffron's eyebrows as she had planned. They both look down at Crystal and in unison focus their beams on her. When they are done, she is still the girl next door, but with dazzling blond hair, a slender waist and bewitching green eyes. "Oooooooh. I LOVE it! Can I have a little bit of muscle too?" "Of course!" they say, happy to oblige. "OOOOH!" she squeals. "More than enough! But they're really cute!" She clenches her fists, makes her muscles jump and growls at Clark threateningly. "RROOOWWF!" Amanda looks at Lisabeth and the way she looks at Crystal and Missy. She shrugs. Lisabeth was an experience. Clark is still cute, and she is still straight. She sidles over to him and bends down. "Bad day?" He nods, unable to believe just how much. "It doesn't have to be ALL bad," she says, giving him a hand and helping him up. "We're all special, in our own way." He looks at her blankly and she tried another tack. "Hey, Clark, do you like cappuccino? Or maybe something stronger?" She guides him to the opposite corner of the shop and quickly orders something to restore his soul. Lisabeth turns to Vrema, who shakes her head. "Well, if you change your mind, Vrema." "I won't. I like me the way I am. But thanks," she says simply. Finally Lisabeth closes her eyes. Her hair darkens slightly to its original shade, her nose sharpens and her lips become a little less full. She looks at herself in the mirror and then at Missy, who nods approvingly. "It's you," Missy says, "and it's really good." "I know, and I feel good about myself. That's what I always really wanted," Lisabeth replies. "And not feeling so vulnerable against guys is a real plus," she grins. Missy rolls her eyes. "Guys are NOTHING to be afraid of. I could teach you so much, if you were interested." Lisabeth laughs. "Well, I don't know. I'm just glad I can do this." She directs a torrent of air at Clark, spraying him with the frappuccino Amanda just brought him, lifting him out of his seat, and pinning him high against the wall until, with Amanda's disapproving eyes on her, she stops the flow of air and lets him crash to the floor. "Whoops!" Crystal giggles. "Though maybe there are a few other things I could learn about them," Lisabeth admits, her eyes roving around the coffee shop and settling on two men eyeing her. "They DO have their uses," Missy maintains, "if you keep them in their place." Lisabeth glances at Clark on the floor, with Amanda bending over him. "Yeah, I can see that." Missy and Lisabeth are relaxed, happy, surrounded by their friends in Starbucks, and now, also, rulers of the universe. "It's been a long day," Missy says. "But a really good day." "We've got some planning to do, and right now, I could use some sun." "Me too, but it's night time, Lisabeth." Lisabeth shrugs. "I know a place where it's always sunny. Come with me." After a few moments Missy relents and they walk outside into the dark. Lisabeth takes Missy's hand. "Let me show you." Lisabeth rises off the ground, pulling Missy into the air. Seconds later, Missy is rising too under her own power, faster and faster. They speed off together, racing each other. Two hours later they are deep inside the sun, fusion reactions in tumult around them. "What a rush!" Missy says, mouthing the words. "So much power!" Lisabeth mouths back. "No limits!" They both say, laughing, shining their white beams, more brilliant now than the heart of the sun, at each other. [HOME AT LAST] THE END